Maintenance of zebrafish stocks and embryo and larvae collection

The maintenance and breeding of zebrafish (Danio rerio) were performed as described previously (Tai et al. 2022). The following lines were used in this study. Wild-type (WT) zebrafish, stmn4 deficient homozygous mutant (stmn4−/−) (Li et al. 2023), Tg(Huc:EGFP)(CZ160)(China Zebrafish Resource Center, http://www.zfish.cn/), and Tg(stmn4−/−; Huc:EGFP). The ages of embryos and larvae were expressed by hours post-fertilization (hpf). The Cu exposure solution was prepared as we performed recently (Zhang et al. 2018). Briefly, embryos were exposed to Cu2+ (CuSO4·5H2O) (Sigma, Cat#61,245) before sphere stage at 3.9 μM (Zhang et al. 2015).

Behavior assays

In this study, stmn4−/− and WT larvae at 96 hpf or 120 hpf in 48-well plates (one larva per well, at least 2–3 repeats for each group) were put into the Zebrafish behavior tracking system (ViewPoint Life Sciences, Montreal, Canada), and the larvae behaviors were recorded for 30 min after the larvae had been adapted for 10 min.

Meanwhile, in touch response assays, stmn4−/− and WT larvae at 96 hpf or 120 hpf were placed in 48-well plates and were stimulated with toothpicks, and video images of their motor behaviors and escape responses after touch stimulation were recorded by Zebrafish behavior tracking system (ViewPoint Life Sciences, Montreal, Canada). The video was broken down by QuickTime Player software (version 10.4, Apple Inc.) to get different time points of each frame, and the time of each frame was displayed on each panel.

Morpholino (MO) and mRNA injection

The morpholinos of p53 was purchased from Gene Tools LLC (Philomath, Oregon, USA) and dissolved in ddH2O at 3 mM (stock solution). The full-length of stmn4 was amplified with the specific primers, F primers: 5’ ATGACCTTGGCAGCATATCGAGACA 3’, R primers: 5’ CTACCGAACTGAAAAGCTACCAGAA 3’, and the stmn4 full-length mRNA was synthesized using the Ambion MAXIscript T7 Kit (Cat#AM1344, Invitrogen, USA) as instructed by the manufacturer. In all experiments, the MOs and mRNAs were injected into one-cell stage embryos, respectively, with the MO dose of p53 at 0.6 mM, and the concentrations of stmn4 mRNA at 200 ng/µL.

Real-time quantitative PCR (qRT-PCR) analysis

Zebrafish embryos at 16 hpf, 24 hpf, and 48 hpf, separately, were used for total RNA extraction. In this study, the expressions of stmn1a, stmn1b, stmn2a, stmn2b, stmn3, stmn4 in stmn4−/− and WT embryos at 24 hpf, of p21, p130, cyclinA2, cdk1, cyclinE, cyclinD, cdc25b, cyclinB, cyclinG2, atm, cyclinA1 and cenp in stmn4−/− and WT embryos at 16 hpf and 24 hpf, and the expressions of p53, bcl2, caspase8, baxa in the embryos at 24 hpf and 48 hpf, were tested, and qRT-PCR was conducted as we reported previously (Zhang et al. 2020). The primer sequences were listed in Table S1. Each sample was run in triplicate and repeated at least three times. Differences were calculated by the 2−ΔΔCt comparative quantization method using 18s or gapdh as an internal control.

Whole-mount in situ hybridization (WISH)

WISH was performed as previously described (Zhang et al. 2020). Probes for myelin basic protein a (mbp), proteolipid protein 1a (plp1a) and vimentin (vim) were synthesized as we performed previously (Zhang et al. 2020), and probes for other genes tested in this study were synthesized using T7 in vitro transcription polymerase (Roche Molecular Biochemicals, Germany) and DIG RNA labeling kit (Roche Molecular Biochemicals, Germany), sequences for all primers used in this study were listed in Table S2. The images were captured by an optical microscope (Leica. M205FA, Germany). Data quantification and visualization were carried out using ImageJ software (NIH, Bethesda, Maryland) and GraphPad Prism 8.0, respectively. A minimum of 15 embryos per group were used for WISH analysis, and three independent experiments were performed. A representative image in each group is shown.

Immunofluorescence and Hematoxylin–eosin (H&E) assays

Embryos and larvae at 24 hpf, 48 hpf, 72 hpf, 96 hpf and 7 dpf were fixed with 4% PFA overnight at 4 °C, and then were dehydrated with 30% sucrose PBS solution for 2 h at room temperature. Next, the permeated embryos were embedded in TissueTek® O.C.T. compound (Sakura Finetek, USA) for cryosectioning at 6 ~ 8 μm in thickness with frozen microtomy (Thermo scientific, USA). After drying at 4 °C, the sections were used for Hematoxylin and Eosin (H&E) staining, immunofluorescence assays, and in situ hybridization (ISH) assays, respectively. The H&E staining and ISH assays was performed as reported previously (Niu et al. 2014; Zhao et al. 2020). Then, high-resolution images for the H&E staining and ISH assay sections were obtained under a microscope (ZEISS Axio Imager A2) after the staining was completed.

The immunofluorescence assays were performed with the primary antibodies against Caspase3 (A0214, ABclone, 1:200), PH3 (AF3358, Affinity, 1:200), Opn1sw2 (Azb21565b, Abcepta, 1:200), Opn1lw1 (A24373, ABclone, 1:100), Rhodopsin (A7245, ABclone, 1:100), Sox2 (A0561, ABclone, 1:200) and the fluorescent secondary antibodies (AS053, ABclone, 1:500; AS058, ABclone, 1:500) at 37℃, 2 h. The cell nuclei were stained with DAPI (5 μg/ml). Immunostaining assays in frozen sections were performed as described previously (Zhao et al. 2020). The apoptosis detection was performed with a TUNNEL detection kit (Elabscience Biotechnology, Wuhan, China). The immunofluorescence and the apoptosis samples were imaged using a confocal microscope (Leica M205FA, Germany).

BrdU labeling and EdU labeling

The stmn4−/− and the control at 46 hpf and 94 hpf, respectively, were injected with BrdU (10 mM; Beyotime, Cat#ST1056) or EdU (10 mM, Abbkine, Cat#KTA2031) peritoneally, followed by incubation for 2 h and fixed in 4% paraformaldehyde (PFA). Next, the permeated embryos were embedded in TissueTek® O.C.T. compound (Sakura Finetek, USA) for cryosectioning at 6 ~ 8 μm in thickness with frozen microtomy (Thermo scientific, USA). After drying at 4 °C, the sections were used for EdU staining, or staining with BrdU Mouse mAb (1:200) antibodies according to the manufacturer’s protocol, and for other antibody immunofluorescence assays, respectively. Finally, the slices were imaged using a confocal microscope (Leica M205FA, Germany).

Western blotting (WB)

Whole embryos and the cut head tissues at 24 hpf and 48 hpf, separately, were homogenized in Radio Immunoprecipitation Assay (RIPA) lysis buffer with proteinase inhibitor (Cat#89,900, Thermo Fisher Scientific, USA). Then, the appropriate SDS-PAGE loading buffer was separately added and the obtained samples were boiled for 10 min. Each protein sample was quantified to make sure an almost equal amount of protein in each line was separated by polyacrylamide gel electrophoresis. The separated protein was transferred to polyvinylidene fluoride (PVDF) microporous membrane (Bio-Rad Laboratories, Hercules, CA, USA). The whole embryo protein samples were used for proteins Stmn4, Sox2, Ccnb1, Cdk1, Cdc25b and α-Tubulin assays via WB, and the cut head tissues protein samples were used for proteins P53, Bcl-2 and Cleaved Caspase3 assays via WB. The blots were then blocked with 0.2% skim milk in TBS containing 0.1% Triton X-100, followed by incubation first with the primary antibodies, Stmn4 (DF4547, Affinity, 1:200), Sox2 (A0561, ABclone, 1:200), Cdc25b (A9758, ABclone, 1:200), Cyclin B1(Ccnb1) (A19037, ABclone, 1:200), Cdk1 (A11420, ABclone, 1:200), α-Tubulin (GT114, GeneTex, 1:200), P53 (80,077–1-RR, Proteintech, 1:200), Bcl-2 (A0208, ABclone, 1:200), and Caspase3 (A0214, ABclone, 1:200), respectively, and then with secondary antibody Goat anti-Rabbit lgG (H + L) in a 1:1000 dilution (Cat#BL033A, Biosharp, China). Finally, the blots were visualized using enhanced chemiluminescence (Bio-Rad Laboratories, Hercules, CA, USA). Multi Gauge V3.0 was used for quantifying the protein levels based on the band density obtained in the WB analysis.

RNA-Sequencing (RNA-Seq) and analysis

In this study, fifty zebrafish embryos of control and stmn4−/− mutants at 16 hpf and 24 hpf were collected separately and used for RNA extraction and RNA sequencing (RNA-Seq). RNA-Seq was performed on an Il-lumina HiSeq2000 platform by Novogene (Beijing, China). Genes with significant alterations due to stmn4 deletion (adjusted P < 0.05) were defined as differentially expressed genes (DEGs). Enriched Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis was conducted for each sample using KOBAS v.2.0 based on the lists of DEGs. Gene Ontology (GO) analysis was conducted using the lists of DEGs by GO seq Release 2.12. Hierarchical clustering was performed by TIGR Multi Experiment Viewer (MeV) to generate different heatmaps.

Statistical analysis

RNA extraction, protein extraction and other experimental samples were collected, about 50 embryos in each group. The sample size for different experiments in each group was larger than 10 embryos (n > 10) with 3 biological replicates for WISH test. The data were quantified by Image J and analyzed and visualized by GraphPad Prism 8.0. The results were passed by t test and post hoc Turkey's test in SPSS (20.0) software. The statistical significance between groups was determined at P < 0.05 (*), P < 0.01 (**) or P < 0.001 (***). Data are expressed as the mean ± standard deviation (SD) for normal distribution and median (range) for no-normal distribution.