Protein is one of the most vital fractions in the feed, which helps livestock husbandry to achieve proper development goals [1]. Enhancing the protein-rich forage in the feed is an effective approach for boosting the energy and protein levels in ruminants [2]. However, the availability and price of protein-rich sources, particularly soybean meal, have become serious problems for animal feed production due to the rapid development of the animal husbandry worldwide [3]. This surge in global soybean meal prices has promoted increased interest in alternative protein sources for ruminant feeding strategies.

Sesbania cannabina is a pioneering forage legume crop which is extensively grown in coastal saline‒alkali soils because of its greater biomass production (45 t ha−1 year−1) and capability to survive under various environmental conditions such as high salinity, waterlogging, and drought [4]. However, the use of Sesbania cannabina for silage production is constrained by its low water-soluble carbohydrate (WSC) content [< 5% dry matter (DM)] and high buffering capacity, which frequently leads to unsuccessful fermentation. Numerous studies have reported that the co-ensiling of legumes (rich in protein) with cereals (rich in WSCs) can achieve good fermentation quality [5, 6], but research on the aerobic stability of such mixed silages is limited. Additionally, cereal grain silage, especially whole crop corn silage, contains greater concentrations of soluble carbohydrates and lactic acid (LA), as well as lower levels of natural antifungal compounds [7], which could increase the susceptibility of mixed silage to aerobic spoilage after opening. Therefore, enhancing the aerobic stability of silage made from Sesbania cannabina and corn (SC) is a conventional practice but a persistent challenge for ensuring high-quality and safe silage production in saline-alkaline regions.

Aerobic spoilage of silage is driven by the proliferation of aerobic microbes like filamentous fungi and yeasts, which can metabolize LA in aerobic environments, thereby resulting in silage deterioration [8]. Silage losses due to aerobic deterioration constitute a substantial restraint to the efficient function of the feed value chain, and the magnitude of these losses is even greater when environmental conditions favor the proliferation of spoilage yeasts and aerobic bacteria. Lactic acid bacteria (LAB) are recognized as an excellent choices for use as natural preservatives in livestock feed to effectively inhibit the fungal growth and mitigate the subsequent mycotoxin production [9,10,11]. LAB species produce a diverse range of antifungal metabolites that effectively control the fungal growth and have capacity to detoxify mycotoxins [12]. Compound LAB inoculation significantly enhances silage quality compared to single-strain inoculation by improving fermentation profiles through synergistic interactions among different LAB strains, which leads to a more balanced production of organic acids, resulting in lower pH levels and improved preservation [13]. Additionally, compound inoculants can increase DM recovery and nutritional value, contributing to better aerobic stability and reduced spoilage when silage is exposed to air, as they could effectively inhibit undesirable microbial growth. Many studies have established that the use of LAB can improve the fermentation quality of silages while enhancing aerobic stability [14, 15], but until now, none of these studies have focused on the aerobic stability of SC mixed silage.

The ensiling process is governed by microbes, which have the ability to improve silage fermentation quality, as well as nutritional quality [16]. To maximize silage utilization as animal feed, thoroughly characterizing the role of microbial communities involved in silage fermentation is essential, as the ensiling process is substantially affected by microbial metabolism, which facilitates the transformation of substrates [17, 18]. However, the quantitative role of microbes in enhancing the aerobic stability of SC mixed silage remains unknown. High-throughput sequencing of the 16S rRNA and ITS regions is employed to assess the relative abundance of various taxa within microbial communities. However, interpreting fluctuations in relative abundance can be challenging, as it may be unclear whether an increase in a specific taxon’s representation signifies a bloom or results from a decline in other taxa [19]. To overcome this limitation, absolute quantification of 16S rRNA (AQ-16S-seq) and ITS sequencing were utilized to accurately capture shifts in microbial populations and precisely evaluate the of microbial metabolic variations associated with enhancing the aerobic stability of SC mixed silage. Absolute quantification surpasses relative quantification in microbial community analysis by providing precise measurements of individual microbial taxa abundances, allowing for more accurate interpretation of their roles and interactions within ecosystems [20].

In this study, we hypothesize that the addition of corn to SC mixed silage may improve the fermentation quality, while concurrently increasing the susceptibility of SC mixed silage to aerobic spoilage. Hence, this study was aimed to elucidate the role of a compound LAB inoculant in enhancing the aerobic stability of SC mixed silage via use of a quantitative microbiome analysis, which is essential for increasing the utilization of protein-rich silage by ruminants.

Experimental proceduresMaterials and silage preparation

Sesbania cannabina (Yanjing 1, at the early flowering stage) and corn (Jingke 932, at the half milky stage) were collected from the experimental field of the Institute of Genetic Development, Tongzhou District, Beijing, China on August 30, 2022. The harvested forages were processed by a forage chopper (92-2S, Sida Agri-Machine Co., Ltd., Luoyang, Chin) to achieve a particle size of approximately 1 to 2.0 cm. The chopped Sesbania cannabina and corn materials were then mixed at the following ratios: 10:0 (S10), 9:1 (S9C1), 7:3 (S7C3), and 5:5 (S5C5). Two primary groups were established in this study: CK, which served as a control group with sterilized water, and LAB, which included a compound inoculant. The strains used as compound LAB inoculant included Lactobacillus plantarum B90 (CGMCC No. 13318, currently known as Lactiplantibacillus plantarum B90), Lactobacillus farciminis GMX4 (CGMCC No.19434; currently known as Companilactobacillus farciminis GMX4), Lactobacillus buchneri NX205 (CGMCC No. 16534, currently known as Lentilactobacillus buchneri NX205), and Lactobacillus hilgardii 60TS-2 (CGMCC No. 19435, currently known as Lentilactobacillus hilgardii 60TS-2). The bacterial strains were preserved in a solution containing 50% glycerol at a temperature of −80 °C. Prior to their utilization, the strains were recovered on de Man, Rogosa, and Sharpe (MRS) agar at 37 °C for a duration of 48 h under anaerobic conditions. Afterward, a selected monoclonal strain was isolated and cultivated in 5 mL of MRS broth at 37 °C in anaerobic conditions until reaching an optical density at 600 nm of 1.0. Subsequently, the bacterial cultures were transferred to a 500 mL culture flask for further proliferation. Finally, a 10-fold gradient dilution coating method was employed to quantify the number of viable bacteria. The LAB inoculants were applied to the SC forages at a rate of 106 CFU/g fresh weight (FW), while for CK group, an equal amount of sterilized water was applied to the SC forages. A total of 500 g of treated forages (three replicates for each group) were loaded into airtight plastic bags and then subjected to vacuum-sealed by vacuum sealer (DZ-AS, 2500KW, ANSEN, Fujian, China). The samples were then allowed to undergo a 60 days of ensiling at ambient temperature (25–27 °C).

Fermentation quality and chemical characteristics analysis

For the analysis of fermentation quality, 10 g of silage samples were blended with 90 mL of sterilized water and shaken for 30 min [6]. The pH of the resulting solution was promptly measured using a pH meter (FE28-bio, METTLER TOLEDO). The quantitative assessment of organic acids, including LA, acetic acid (AA), propionic acid (PA), and butyric acid (BA), was performed using high-performance liquid chromatography (HPLC) equipment (1200, Agilent, California, USA). The mobile phase was maintained at a temperature of 55 °C, with a flow rate of 0.6 mL/min for a 0.005 M H2SO4 solution [10]. The concentration of ammonia nitrogen (NH3-N) was determined using ninhydrin colorimetric and phenol-hypochlorite methods, as previously reported [21].

For the chemical composition analysis of both fresh and ensiled samples, the samples were first dried in a forced-air oven at 65 °C to determine their DM contents. Subsequently, the dried samples were ground, and the contents of crude protein (CP), neutral detergent fiber (NDF), acid detergent fiber (ADF), acid detergent lignin (ADL), and starch were quantified using methodologies outlined by the Association of Official Analytical Chemists [22]. Additionally, water-soluble carbohydrate (WSC) content was measured by an automated procedure of Arthur Thomas [23].

Aerobic stability analysis

Aerobic stability analysis was carried out following a previously documented method [10]. Briefly, the silage bags were unpacked after 60 days of ensiling to evaluate their aerobic stability. The replicates from each group were bulked into a single sample and then approximately 1.5 kg of silage material was placed in 3-L heat insulating containers without compaction and stored at 25 °C. The room temperature and temperature within each container were simultaneously recorded for 14 consecutive days by inserting a Multi-Channel Data Loger (SMOWO, Model: MDL-1048A; Shanghai Tianhe Automation Instrument Co., Ltd., China) into the geometric center of the silage mass. To minimize contamination and drying, two layers of cheesecloth were placed over each container. We defined the aerobic stability as the number of hours that the temperature of silage was maintained before it was increased to more than 2 °C above room temperature. Subsamples (20 g) were collected when the silage started to deteriorate for microbial community analysis.

Cultured-based microbial analysis

For microbial analyses, part of silage extract for fermentation quality analysis was filtered through a single layer of sterilized gauze and a series of dilutions were prepared. The filtrate was subsequently inoculated onto Man Rogosa Sharpe (MRS) and Potato Dextrose Agar (PDA) under sterile conditions to quantify the populations of LAB and yeasts, respectively. The MRS plates were kept in anaerobic chamber at 37 °C for 48 h, while the PDA plates were kept at 30 °C for 72 h. The microbial populations are expressed as CFU/g of FM and were subsequently transformed logarithmically to facilitate analysis.

Sequencing-based microbial analysis

The microbiota of SC mixed silage was analyzed after 60 days of ensiling and at the time when silage started to deteriorate. Microbial DNA was collected from silage samples using a soil DNA extraction kit (Yeasen, Shanghai, China), following the protocols outlined by the manufacturer. The extracted microbial DNA was analyzed with paired-end sequencing (2 × 250 bp) at Genesky Biotechnologies Inc. (Shanghai, China) using an Illumina MiSeq platform, following the guidelines outlined by the manufacturer. For bacterial analysis, the V3-V4 regions of the 16S rDNA gene were amplified using the primers 341F (CCTACGGGNGGCWGCAG) and 805R (GACTACHVGGGTATCTAATCC). Fungal community profiling was conducted via ITS amplicon sequencing employing the universal primers ITS1F (5′–CTTGGTCATTTAGAGGAAGTAA–3′) and ITS2R (5′–GCTGCGTTCTTCATCGATGC–3′). The sequenced reads were processed according to the methodologies established in a previous study [24]. In brief, the QIIME quality-control pipeline (version 2.15.3) was employed to generate high-quality clean tags, while the UCHIME algorithm was utilized to identify and eliminate chimeric sequences. The microbial species annotation of OTUs was performed using the RDP 11.5 database, whereas fungal species annotation of OTUs was performed using the UNITE 9.0 database. Alpha diversity was assessed through several metrics, including ACE, Simpson, Chao, Shannon, and Good’s coverage. The predicted functional characteristics of the bacterial community were analyzed using the Kyoto Encyclopedia of Genes and Genomes (KEGG; http://www.genome.jp/kegg/) database through PICRUSt2 (https://github.com/picrust/picrust2; Version 2.2.0) [25]. The sample heatmap analysis on the absolute abundance of Pathway level 3, associated enzymes, and modules were constructed by R program (Version 4.2.0). The raw sequencing files and associated metadata have been deposited in the National Center for Biotechnology Information (NCBI) Sequence Read Archive (PRJNA1162944).

Antimicrobial activity test

The antimicrobial activity of selected LAB strains as a compound additive and LAB strains isolated from SC mixed silage was further investigated against Kazachstania humilis (Table S1). The antimicrobial activity of LAB was determined by using an agar well diffusion antimicrobial assay and the optical density (OD) method [26]. For the agar well diffusion assay, Kazachstania humilis was inoculated into a test tube containing 15 mL of YPD broth and incubated at 30 °C for 24 h to obtain active cultures. The active culture of Kazachstania humilis was added to YPD agar when its temperature reached to less than 40 °C, mixed well and then poured into petri dishes. Four wells, each with a diameter of 6 mm, were created using sterile blue Pasteur pipette tips. Then, an aliquot of 100 µl from an overnight culture of LAB isolates in MRS broth was introduced into the wells. The inoculated plates were placed were subsequently incubated for 24 h at 30 °C. After incubation, the plates were examined for the presence of zone inhibition surrounding the wells. For the OD method [27], the LAB and Kazachstania humilis were grown in MRS and YPD broths at 37 °C and 30 °C, respectively. The LAB cultures were transferred to 2 mL test tubes containing YPD broth. A fixed amount of Kazachstania humilis culture (100 µL of 106 CFU/mL) was added to each tube containing various LAB cultures and the control was set by adding MRS broth without LAB. The test tubes were subsequently incubated at 30 °C for 12 h. The value of OD600 was measured with a spectrophotometer after 12 h of incubation.

Statistical analysis

The data were assessed using SPSS software (Version 19.0; IBM Corp., Armonk, NY). Variations between operational phases in the CK and LAB groups were examined employing analysis of variance (ANOVA) [28]. Meanwhile, t-test was used to compare the operational phases within the same ratio under different groups. The Pearson correlation analysis was employed to analyze the associations among the microbiota and fermentation indices. The graphics of data was performed by GraphPad Prism 8.0, while microbial data was plotted by Chiplot (https://www.chiplot.online/).