Since the demonstration that G4s were transient forms in cells [20], the therapeutic significance of G4 targeting drugs has become apparent. Many compounds with diverse structures have been tested for efficacy as G4 binders but only a small fraction of them have been structurally characterised with G4s. A search of the Protein Data Bank (PDB) (or the Nucleic Acid Knowledge Bank (NAKB)) yields nine sets of experimentally derived structural coordinates of the G4-metal complex systems obtained using X-ray crystallography and nine using NMR, as shown in Tables 1 and 2, respectively.

The importance and therapeutic application of metal ions in nucleic acid chemistry has been known and studied for a long time. The ionic atmosphere around DNA, due to the negative charges on the phosphate backbone, affects everything from the local folded structure to the vulnerability of the genomic code to damage [60, 61]. Specifically, in the telomeric assembly, there are two central K+ ions, each coordinated in distorted square antiprismatic coordination to eight guanine bases, through the carbonyl group at the 6-position (Fig. 1). These K+ positions are integral to biologically relevant G4 structures, clearly defined using X-ray diffraction, but have to be inferred in NMR structure determinations. The binding of positively charged metal complexes can also contribute to the neutralisation of the overall negative charge of the G4. To date, metal complexes of Co(III), Ni(II), Ru(II), Pt(II) and Au(I)/(III) have been studied as potential therapeutics and probe molecules, making use of the combination of extended planar ligands and either square planar or octahedral geometry. The ligand binding preferences of these metals allow an endlessly diverse range of complexes to be generated. None to date have been studied in quite such a systematic way as potential therapeutics as the acridine example above. Given the large interest in such complexes, rather little structural information has been published showing their interactions with G4s. Currently, only 18 structures are present in the PDB (nine X-ray diffraction and nine solution NMR), and the area is ripe for further development.

Initially developed by qualitative modelling investigation, the metal-salphens have since been shown to be strong G4 binders and potent inhibitors of telomerase [62,63,64]. Consisting of a heteroaromatic bis-Schiff base derivative 4-coordinated to a square-planar/pyramidal metal centre, this family of complexes has been systematically optimised to be proficient binders of telomeric G4. Indeed, different strategies like the design and synthesis of dimeric Pt(II) salphen compounds to target consecutive G4s at the telomeric region have been employed [65]. Central metal ion type, coordination geometry, and substituent effects have all been investigated.

For this purpose, Vilar et al. investigated a series of metal complex (Ni2+, Cu2+, Zn2+, and V4+) analogues with DNA having square-planar and square-based pyramidal three-dimensional structure [63]. These experiments highlighted the importance of the coordination geometry around the metal complex, demonstrating how square-planar metal-centres such as Ni2+, thanks to this geometry, can easily п-stack on top of the G-quartet, stabilising the G4 structure. On the other hand, a square-based pyramidal geometry, as in the Zn2+ complex, displayed almost no affinity towards G4.

In addition to increasing solubility, the number and nature of the substituents located on the salphen ligand largely dictate the resulting affinity and structural selectivity of the complex. As with the acridines, FRET analysis helped to establish that pyrrolidinium and piperidinium were the most suitable heterocyclic ends for the ether-linked alkyl substituents [63]. However, Vilar et al. found that derivatisation around the central phenyl ring was more important. (Fig. 6a). Phenyl ring substitution always led to a decrease in FRET melting temperature with a telomeric 22-mer sequence [42], but substitutions can also improve selectivity between duplex and quadruplex DNA. Investigation into the effect of the central ion concluded that square planar Ni(II) and Cu(II) complexes were more stabilising and showed higher antiproliferative properties and effective telomerase inhibition when compared to the pseudo-square-4pyramidal Zn(II) and V(IV) complexes; presumably because the square planar coordination allows the metal to sit close to the K+ channel [66].

Salphen metal complexes. a The salphen complexes used, with the fluorinated central phenyl ring; b, c Two views of the copper complex (PDB code 3QSC) bound to d(AGGGTBrUAGGGTT), highlighting the lateral and top view, respectively; d Superimposition of the two salphen structures, 3QSF and 3QSC, coloured as blue light and grey, respectively, highlighting the close similarity between the two structures; e, f Two views of the nickel complex analogue (PDB code 3QSF)

Crystal structures of square planar Ni(II) and Cu(II) metal salphens (Fig. 6a) bound to a bimolecular brominated sequence based on the human telomeric d(GGGTTA)n unit have been reported [42]. Both structures (Fig. 6b–f) contain biological units comprised of a bimolecular all-parallel quadruplex formed by d(AGGGTBrUAGGGTT) with a two-fold symmetry axis running down the central (helix) axis, and the metal complex disordered about this axis. Hence, in Fig. 6c, f, which are projections down this symmetry axis, only one of the two disordered complexes is shown for clarity, but the asymmetric unit (smallest repeating unit) is the 12-mer single strand. The assembly is stacked on a second symmetry-related unit, giving a run of five K+ ions. These points are mentioned as they are representative of features often seen in crystal structures which would not be present in solution. In NMR-determined structures, the ligand binding mode would typically be the same, but such aggregation would be unusual. In these examples, the complexes are seen to bind in a typical end-capping fashion, as previously suggested by molecular modelling calculation; however, the flipping in of the terminal thymine is unexpected, stacking over the ligand as shown in Fig. 6c, f. As designed, the central metal ions of the complex are situated almost in line with the K+ channel but cannot directly coordinate to any guanine 6-carbonyl group. Although containing different metal centres, the overall assemblies are isostructural. The authors noted deviations from planarity of the salphen ligand when comparing the bound Ni(II) and Cu(II) complexes, with the Cu(II) bent out of plane. This additional bowing affects the π-stacking overlap with the G-tetrad, giving a difference in stacking distance of 0.2–0.3 Å, consistent with the lower binding affinity of the Cu(II) complex. In addition, the structure allowed the authors to propose a rationale for the decrease in affinity seen on substitution of fluorine in the central phenyl ring. Although included to increase favourable π-stacking by electron withdrawal, the structure actually shows that the substituted ring is only partially overlapping with the adjacent base, and unfavourable repulsive interactions occur between a fluorine and a guanine carbonyl group. Substitution of donor groups at this position could exploit this interaction. The structure is, therefore, a very nice example of the use of such data to interpret biophysical and biochemical results.

Related salphen-like metal complexes containing Ni(II), Cu(II), and Zn(II), but incorporating imidazole rings were subsequently studied [67]. DNA binding affinity showed that the three salphen-like complexes have a similar binding affinity towards calf-thymus DNA (CT-DNA), but differences were observed when G4 DNA was added: Cu(II) > Ni(II)> Zn(II). Interestingly, MD simulations show a loop binding mechanism of the Cu(II) analogue with the human telomeric sequence. The diversity of salphen-like metal complexes has been further extended with the synthesis and characterisation of non-charged Cu(II), Ni(II), Zn(II), Pd(II) and Pt(II) metal complexes, bearing chlorine atoms as substituent, and to salphen Co(III) complexes [68, 69].

Gold-centred organometallics have been developed as potent cytotoxins with structural selectivity. Gold(I) mono/dicarbene species are especially promising candidates due to their physiological stability, antineoplastic activity, and lower systemic toxicity than earlier cytotoxic gold complexes [70]. N-heterocyclic gold(I) carbene (NHC) complexes have been shown to be potent inhibitors of mitochondrial selenoenzymes, as well as inhibitors of proteasome and telomerase activity [71, 72]. Antitelomerase activity has also been shown to be a distinct mode of action for the antiproliferative effect of Auranofin; a repurposed gold(I) thiolate-based antirheumatic agent that has been in clinical trial for the treatment of ovarian cancers, with a mode of action distinct from that established for the platinum compounds [73].

The cationic gold(I) bis-carbene, [Au(9-methylcaffein-8-ylidene)2]+ has been shown, using an in vitro FRET melting assay, to be completely quadruplex specific in its binding and, later, to be a selective cytotoxin to cancer cells [74, 75]. The binding mode of this complex to the telomeric G4 forming sequence d(TAGGG(TTAGGG)3) has been structurally characterised in a combined X-ray crystallographic and ESI-MS study [76]. The crystal structure (PDB: 5CCW) shows that the parallel topology of the quadruplex is maintained upon binding of the complex (Fig. 7a). Also supported by solution MS, the structure shows how the complex binds by end-capping on both 5′ and 3′ tetrad faces in a maximum 3:1 stoichiometry across the biological unit. Two complexes fit neatly side by side on one face, each end-stacking with two guanine bases, and showing minimal loop interaction with the propeller loops. A single complex end stacks to the opposite face.

Gold complexes. Chemical structures and refined crystal structures of the gold complexes that have been structurally characterised with G4 DNA. PDB code from left to right: a 5CCW, b 6H5R, and c 7QVQ. In this example, only a single orientation of the four-fold disordered complex is shown for clarity (see text)

In a related experiment, the interaction of a simple gold(I) bis-carbene [Au(NHC)2]+ was investigated in the presence of different telomeric G4s [77]. Crystallisation was achieved with the sequence d(TAGGG(TTAGGG)3T) (PDB: 6H5R) and similarly produced an all-parallel topology (Fig. 7b), but in this case, the complex is observed at a stoichiometry of 1:1 to a biological unit of a single DNA strand, as adjacent quadruplexes are stacked to give a dimeric unit in the crystal. Mass spectrometry also suggested a 1:1 binding stoichiometry, and melting analysis indicated no clear increase in ∆Tm. The complex, which is disordered on the G-tetrad surface, is π-stacked across two guanine residues on the 3′ tetrad; as with structure 5CCW, the metal centre is not aligned with the central ion channel.

Figure 7c shows the structure deposited with PDB code 7QVQ, and is included for completeness. The planar gold(I) complex shown has been crystallised with the parallel G4 formed by the 24-mer human telomeric sequence (Table 1). The resulting deposited coordinates and experimental measurements show that the crystal used for the analysis contains quasi-infinite stacks of the complex alternating with the parallel G4, in 1:1 stoichiometry, with unclear density for the metal complex, typical of disordered binding. The depositors have modelled four orientations of the complex into the density, with just one orientation illustrated in Fig. 7c. This is a rare example where the amount of useful information in the structural data is limited, and does not go much further than confirming the end-stacking binding mode.

Organometallic gold(III) complexes, such as the N-heterocyclic dioxo bridged binuclear complex shown in Fig. 8a, have been shown to exhibit similar in vivo cytotoxicity (low µM), and inhibition of selenoenzymes, proteasome action and telomerase, to the gold(I) carbene species [78, 79]. The complex (Fig. 8a), which has exhibited marked G4 affinity and selectivity, was the subject of a structural investigation, in which the interaction of the complex with the telomeric sequence d((TTAGGG)4TT) was analysed using solution NMR methods (Fig. 8b, c) [80]. The ligand π-stacks on the 5′ tetrad in a pseudo threading/end-capping fashion and, thanks to its large footprint, interacts with three separate guanine bases within a single tetrad. In comparison with the native NMR structure (PDB: 2JPZ), the DNA loop regions in the bound complex have undergone structural rearrangement (RMSD = 3.4 Å) to accommodate the ligand, but the overall hybrid 2 topology is conserved. The Au2O2 central bridge is symmetrically stacked above the inferred K+ ion positions (the K+ locations cannot be determined directly from NMR data), and no direct gold-guanine base interactions were seen.

Dimeric gold complex. a Chemical structure and b NMR models of the gold complex structurally characterised with G4 DNA (PDB: 5MVB). c Superimposition of the G4 sequence upon binding by the ligand and as the native (PDB: 2JZP)

Unlike the metal salphens and other planar cationic species, the central metal ions in the available gold structures show no tendency to stack in line with the K+ channel. In the case of gold, the positive charge will be much more delocalised over the ligands, so this is not surprising. In the absence of steric limitations, in these cases, electrostatics and favourable π overlap influence the binding pocket more than the presence of a metal centre.

Octahedral metal complexes, principally those of ruthenium(II) with its 4d6 electron configuration, have also been examined as promising G4 binders. Unlike the square planar examples considered above, structural evidence shows the metal centre lying in a groove of the G4, with one polypyridyl ligand sitting on a terminal G-quartet, and two other ligands (often called ancillary ligands in the coordination chemistry literature) making contacts within the groove. The inherent three-dimensionality is a key property when aiming for topological specificity, since secondary DNA interactions with ancillary ligands can, enantiospecifically, change preference between topologies by interaction with strand polarity, syn/anti sugars, and loop regions at the binding site, resulting in a form of G4 intercalation. Modification of the structure of the intercalating ligand, by incorporation of specific functional groups or expansion of the ligand scaffold to larger π-extended ligands, leads to G4 specificity over duplex DNA. Work from our own group has demonstrated how these two approaches can lead to the design of metal complexes with such G4 specificity, combined with possibly useful photoproperties.

In 2019, we provided the first crystallographic evidence of two different mononuclear ruthenium polypyridyl complexes, rac-[Ru(TAP)2dppz]2+ (TAP = 1,4,7,10-tetraazaphenanthrene) (dppz = dipyrido[3,2-a:2′,3′-c]phenazine) and the analogue rac-[Ru(TAP)2(11-CN-dppz)]2+ bound to tetramolecular G4s [81, 82]. The DNA sequence d(TAGGGTTA) assembles to give a tetrameric quadruplex which is parallel-stranded when unbound, but which crystallised antiparallel, each lambda metal complex stabilising one syn-guanosine conformation, to give an assembly with four metal complexes and four DNA strands (Fig. 9a). The delta enantiomers of the complex do not bind to the G4 at all, but stack at the end of the assembly in the crystal lattice. Remarkably, the truncated sequence d(TAGGGTT) crystallised with the pure lambda enantiomer of the unsubstituted complex [Ru(TAP)2(dppz)]2+ to give a strikingly different structure in which there are four different metal complex environments, none involving any contact between the dppz ligand and the G-quartets. This result unexpectedly confirmed the strong effect of dppz substitution by the cyano group, the electron withdrawal by this group enhancing the donor-acceptor nature of the stacking interaction.

Luminescent ruthenium complexes. a, b Chemical structure of [Ru(phen)2(11-CN-dppz)]2+ ruthenium complex by itself and bound to the tetramolecular d(TAGGGTTA) G4 (PDB: 5LS8), as the TAP analogue. Lambda enantiomers of the complex are represented as spheres. c Λ-[Ru(phen)2(11-CN-dppz)]2+ bound to the sequence d(TCGGCGCCGA) (PDB: 6HWJ)

Structural analysis of the binding of Λ-[Ru(phen)2(11-CN-dppz)]2+ to the duplex-forming d(TCGGCGCCGA) helped to interpret the structure-selective luminescence behaviour of this metal complex upon G4 binding compared to duplex DNA (Fig. 9) [83].

It can be seen from the structure in Fig. 9b that, when bound by end-stacking to the G4, the intercalating ligand is well protected and embedded by the G4 DNA structure. In this case, the binding mode is truly intercalative because the antiparallel assembly contains AT base pairs. Therefore, no quenching by the surrounding water molecules is possible. On the other hand, when bound to duplex DNA (Fig. 9c), the -CN group on the dppz ligand protrudes into the major groove. This structural analysis is useful to understand the difference in luminescence behaviour when the light-switch complex Λ-[Ru(phen)2(11-CN-dppz)]2+ interacts with both DNA forms. Indeed, we observe that the complex is non-emissive when bound to CT-DNA but luminescent when bound to G4 [81].

The second approach we have used to increase the binding affinity and specificity towards G4 structures consists of using larger π-extended ligands. This approach led to the synthesis of [Ru(phen)2qdppz]2+ (qdppz = 12,17-dihydro-naphtho-dipyrido-phenazine-12,17-dione) and its hitherto unknown TAP analogue [43].

Here, Λ-[Ru(phen)2qdppz]2+ (Fig 10a) was crystallised with a modified human telomeric G4 sequence (GGGTTA)2GGGTTTGGG in an antiparallel chair topology with 1:1 stoichiometry. A structural characteristic of this type of G4 topology is the non-planarity of the bases, which can be observed in Fig. 10b. This lack of planarity of the G-quartets suggests that ligands designed to target this specific topology could have some flexibility, in this case by the curvature of the qdppz ligand shown in Fig. 10c. Here, the ligand overlaps with all the four bases of the G-quartet and shows a bend of approximately 12°. [Ru(phen)2qdppz]2+ demonstrates high enantiospecific binding towards G4 DNA in solution. Replication assays show higher inhibition of replication for the Λ-enantiomer compared to the Δ towards both the native htel21 and the modified htel21T18.

Ruthenium complex with extended angled ligand. a Chemical structure of [Ru(phen)2(qdppz)]2+ ruthenium complex structurally characterised with unimolecular chair form G4 in b (PDB: 7OTB). c Superimposition of the structure containing Λ-[Ru(phen)2qdppz]2+ ruthenium complex (cyan) with the earlier tetrameric structure PDB: 5LS8 containing Λ-[Ru(TAP)2(11-CN-dppz)]2+ (grey)

Sometimes, X-ray crystallography can be a frustrating business due to the inherent properties of the crystals at hand. Although of no interest other than a warning, diffracting crystals can sometimes contain intractable disorder issues, which only become clear once data is collected and model building starts. The example now described is included because the result is relevant to the topic of this review, but the technical problems are only of interest to those interested in what are described as pathological crystals [84]. In this case, the same modified telomeric sequence was crystallised with the enantiomers of the linear analogue of the qdppz complex: linqdppz (Fig. 11). Unlike most of the examples discussed in this review, the crystallographic unit cell contained six copies of the bound G4, with an overall topology, as expected, similar to that shown in Fig. 10b. The data statistics included a strong warning that there was non-crystallographic symmetry (an almost exact repeat), and the problem is that it causes very atypical distributions of intensity in the diffraction data. The ‘almost-repeats’ have small differences which cannot be extracted from the experimental data. In this case, five out of the six assemblies can be successfully refined, leaving an intractable structural problem that is not acceptable in a structural database of primary data. The important and instructive result, worthy of note here, is that it is the delta enantiomer which is bound. The ligand in the resulting assembly is of the correct length for the G4 assembly, but the reason for the delta preference is not obvious from the structure. The ligand appears completely planar, in contrast to the bending seen with qdppz.

Ruthenium complex with extended linear ligand. a Chemical structure of [Ru(phen)2(Linqdppz)]2+ ruthenium complex crystallised with the antiparallel chair form G4 formed from the modified telomeric sequence d(GGGTTAGGGTTAGGGTTTGGG). b–d different perspectives of the structure containing Δ-[Ru(phen)2(linqdppz)]2+ ruthenium complex with the G4. Three potassium ions are clearly present (purple spheres)

Inclusion of such large hydrophobic ligands often negatively affects solubility and subsequently bioavailability, so additional metal centres can be coordinated to offset this. Such bimetallic systems may have slow binding kinetics, which can make NMR structure determination a realistic option. Species such as [Ru(phen)2(tpphz)]2+ (tpphz = tetrapyridophenazine) (Fig. 12) and the dinuclear derivative [2(tpphz)]4+ were reported earlier for their explicit quadruplex luminescence responses and potential as in cellulo probes; the latter of which has also been structurally evaluated by Thomas et al. [85]. Using a combined NMR-MM methodology, the group investigated the enantiospecific binding of ∆∆/ΛΛ-[2(tpphz)]4+ to the anti-parallel basket formed when Na+ is the central cation with the telomeric sequence d(AG3(TTAG3)3). In previous work, they noted high affinities for the system and determined an intense blue-shifted luminescence response of the racemate that had been attributed almost entirely to binding to antiparallel topologies with longer diagonal loops (≥3 nucleotides) [86]. They observed that the ΛΛ-isomer of the phen analogue is responsible for the bulk of the response (6-fold higher than ∆∆ at saturation), highlighting the enantiomeric differences in the interaction. Unfavourable relaxation rates hampered the NMR studies of the phen derivative, with primary NOE signals interpreted as binding of the two enantiomers to opposite G-tetrads. NOE derived structures and unconstrained MD simulations were successful in generating bonding models for the bpy analogue. Little perturbation of the native DNA conformation was seen upon binding of the ∆∆-enantiomer, and the complex was shown to stack on the opposite ‘loopless’ G-tetrad in end-capping mode. Conversely, the ΛΛ-complex was modelled as threaded through the diagonal loop of the basket topology. The guanosine residues adjacent to the central diagonal loop are modelled as somewhat perturbed by the threading, buckling the distal G-tetrad and creating a tight binding cavity around the chromophore. Ancillary ligand interactions with neighbouring ribose sugars are observed, and it is clear to see that assuming the same binding modes, these secondary interactions would be enhanced by the larger π-surface of the phen analogue. Generation of the Van der Waals surfaces for both structures highlights the encapsulation of the ΛΛ-chromophore, in contrast to the solvent-accessible binding of the ∆∆, and providing a structural rationale for the observed higher luminescence of the ΛΛ-enantiomer.

Diruthenium complexes. Chemical structure of the Ru complex that has been structurally characterised with G4 DNA, and NMR models of the interaction of the two enantiomers with the sequence, d(AG3(T2AG3)3). In both cases, the complex end-caps the tetrad stack; the ΛΛ-complex threads through a diagonal loop and generates additional π-stacking with ancillary ligands. The increased luminescence response of the ΛΛ-Ru in relation to the ∆∆-Ru isomer has been attributed to the additional encapsulation of the chromophore by the diagonal loop

The general structure of platinum “tripods” consists of a central non-planar tertiary amine in possession of three long pendant arms or triphenylamine (TPA) tripods, comprising three aromatic rings and capped with platinum-centred units. These triphenylamine tripods are of particular interest as they have been known for a long time to be both efficient DNA minor groove binders, due to their particular three-dimensional structure, and promising materials for two-photon absorption application (2PA) useful for DNA staining and cell death imaging [87,88,89,90,91,92,93].

The spectroscopic properties of TPA, in addition to their structural similarity to those of other G4 binders, inspired Garcia-España et al. to design appropriate TPA to selectively target DNA G4 structures [94, 95]. Further conjugation of TPA to peripheral platinum centres was undertaken to enhance the ability of these organic molecules to produce reactive oxygen species (ROS) due to the heavy atom effect of the platinum atoms. This combination led to the development of platinum tripods as promising for DNA-targeted photodynamic therapy [96,97,98]. Platinum tripods can indeed interact with DNA in the nucleus, inducing ROS generation upon light irradiation, with consequent DNA damage and cell apoptosis. This dual functionality makes platinum tripods effective not only in targeting specific DNA structures but also in promoting cell death through oxidative stress.

Zong-Wan Mao et al. reported a platinum-based tripod capable of binding with fair specificity, to the hybrid-1 telomeric G4, and this ligand-mediated stability effectively inhibits the activity of telomerase in vitro (IC50 = 1.22 µM) shown by a TRAP-LIG amplification assay.

NMR structural studies have defined two different binding stoichiometries (Fig. 13). The hybrid-1 structure has two distinct G-quartet ends, which can be distinguished as the 5ʹ and the 3ʹ ends. At 1:1 stoichiometry, the complex binds at the 5ʹ end, off-centre from the helical axis. The platinated arms protrude through the grooves of the quadruplex, with one of the arms partially enveloped by an A·A·T triad, possibly defining the selectivity. At the higher stoichiometry (right-hand panel), a second Pt-tripod unit stacks similarly, on the 3′ tetrad face. Even though this is a solution structure, the NMR data is interpreted by these authors as a dimeric assembly, linked by the terminal bases. The complex itself is a departure from the norm for quadruplex binding agents; containing no extended planar π-surfaces, and containing active metal centres that are designed to protrude away from the central quadruplex stack. The platinum centres are not directly involved in G4 recognition.

Platinum tripods. The non-planar Pt-tripod complex has been investigated in the presence of the human telomeric sequence, d(A3(G3T2A)3G3A2), using NMR and subsequent NOE restrained MD. Two discrete structures were obtained from different stoichiometries, highlighting two distinct binding pockets but an overall preference for binding to the 5′ tetrad. Note the shifted location of the tripod in relation to the terminal tetrad; presumably to increase π-stacking and allow the platinated arms to fit into the grooves without dislocating the DNA backbone

Petitjean et al. in 2021 reported the first crystal structure of a platinum(II) complex with the 22AG telomeric sequence crystallised in K+ buffer [