Patient samples

We obtained a cohort of 139 HCC patients who underwent primary resection at Sun Yat-sen University Cancer Center (Guangzhou, China) for prognosis analysis and correlation analysis. To compare Siah-1 expression between HCC tissues and adjacent nontumor tissues, another 34 fresh paraffin-embedded HCC specimens were obtained from the Third Affiliated Hospital of Sun Yat-sen University (Guangzhou, China). Surgical tumor resection was performed on each patient in the Department of Hepatobiliary Surgery. HCC tissues were cut into the proper size and fixed in 4% paraformaldehyde for immunohistochemistry. The study was approved by the Institute Research Ethics Committee at the Sun Yat-sen University Cancer Center and the Third Affiliated Hospital of Sun Yat-sen University (ethics numbers: [2018]02–033-01). Written informed consent was obtained from each patient.

Animal experiments

C57BL/6 mice (6 weeks, male) were purchased from GemPharmatech (Jiangsu, China). All mice were handled according to the Guide for the Care and Use of Laboratory Animals. The procedures were approved by the Institutional Animal Care and Use Committee of the Third Affiliated Hospital of Sun Yat-sen University (ethics numbers: 2023F207).

For subcutaneous tumor xenograft models, all C57BL/6 mice were randomly divided into 4 groups. A total of 2 × 106 Hepa1-6 cells(shNC or shCacyBP) were injected into the hind flanks of the mice. Tumors were allowed to grow for 7 days and then the mice were administrated with PBS or anti-PD-1 antibody(Bio X Cell, 200 μg/mouse, intraperitoneal injection) every 3 days. Tumor growth was monitored every 3 days, and the mice were euthanized after 13 days post-injection via cervical dislocation. All tumors from each group were extracted and weighed. The tumor volume was measured using the following formula: 0.5 × (larger diameter) × (smaller diameter)2.

For orthotopic tumor xenograft models, C57BL/6 mice were randomly divided into 2 groups. A total of 1 × 106 shNC or shCacyBP Hepa1-6 cells(1 × 106 cells/mouse) were mixed with Matrigel matrix(354234, Corning) and orthotopically injected into the hepatic capsule of the right liver lobe. After 7 days, the mice were euthanized by cervical dislocation, and livers were collected for histological and flow cytometric analyses.

Reagents and antibodies

Commercially available reagents and antibodies used in this study are listed as follows: hIL-1β (8900, Cell Signaling Technology), hCX3CL1 (30–31-20, Proteintech), PMA (16561–29-8, Sigma-Aldrich), MG132 (474,790, Calbiochem), CHX (C7698, Sigma-Aldrich), in vivo PD-1 antibody (BE0146, BioXcell), anti-CacyBP (11745–1-AP, Proteintech), anti-Myd88 (4283, Cell Signaling Technology), anti-Myd88 (SC74532, Santa Cruz, for immunofluorescence only), anti-Siah-1 (GTX55799, GeneTex), anti-Myc-tag (2276, Cell Signaling Technology), anti-HA-tag (3724, Cell Signaling Technology), anti-Flag-tag (F3165, Sigma-Aldrich), anti-Tubulin (66031, Proteintech), anti-HDAC1 (34589, Cell Signaling Technology, for ChIP assay), anti-HDAC1 (5356, Cell Signaling Technology, for western blotting), anti-HDAC2 (5113, Cell Signaling Technology), anti-HDAC3 (3949, Cell Signaling Technology), anti-HDAC4 (7628, Cell Signaling Technology), anti-HDAC6 (7558, Cell Signaling Technology), anti-Lamin B1 (66095–1, Proteintech), anti-β-actin (66009–1, Proteintech), anti-GAPDH (60004–1, Proteintech), anti-H3K9ac (9649, Cell Signaling Technology), anti-H3K27ac (8173, Cell Signaling Technology), anti-CD68 (ab182422, Abcam), anti-CD206 (ab64693, Abcam), anti-CD206 (141704, Biolegend, for flow cytometry only), anti-CD4 (25229, Cell Signaling Technology), anti-CD8 (98941, Cell Signaling Technology), anti-F4/80 (123137, Biolegend), anti-CD163 (ab182422, Abcam), anti-phospho-p65(Ser536) (3033, Cell Signaling Technology), anti-CX3CL1 (MAB3651, RD), anti-Arg-1 (12–3697-82, Invitrogen), anti-CD11b (101212, Biolegend), anti-Ly6c (128024, Biolegend). All other chemical reagents were obtained from Sigma-Aldrich, unless otherwise indicated.

Cell culture

Human HCC cell lines, PLC/PRF/5 and Huh7, human embryonic kidney cell line, HEK293T, human leukemia monocytic cell line, THP-1 and murine hepatoma cell line from a C57L mouse, hepa1-6, were purchased from Cellcook Company (Guangzhou, China). All cell lines were cultured in Dulbecco’s modified Eagle’s medium (DMEM) or RPMI-1640 medium containing 10% fetal bovine serum (FBS) in a humidified incubator with 5% CO2 at 37 °C. All cell lines were thawed from early passage stocks and passaged every 2 days.

Plasmid construction and transfection

The complementary DNA (cDNA) encoding full-length human CACYBP, SIAH1 and MYD88 genes were amplified using PCR from a cDNA library of HEK293T cells and subcloned into the pcDNA3.1( +) vector (Invitrogen). During PCR, a sequence encoding a Flag tag (GATTACAAGGATGACGACGATAAG) or a HA tag (TACCCATACGATGTTCCAGATTACGCT) was added to the C-terminus of Myd88 and Siah-1 or the N-terminus of CacyBP, respectively. Serial Myd88 truncation mutants were generated by deleting the corresponding protein domains: △TIR, deleting amino acids 159 to 296; △INT, deleting amino acids 117 to 155; and △DD, deleting amino acids 54 to 110. Correct constructs were all confirmed using DNA sequencing. Transient transfection was performed using ViaFect Transfection Reagent (Promega) following the manufacturer’s suggested procedures.

RNA isolation and real-time quantitative PCR (qRT-PCR)

Total RNA from cultured cells were isolated with TRIzol reagent (Sigma-Aldrich) and 2 μg of purified RNA was reverse-transcribed using the GoScript Reverse Transcription System (Promega). qRT-PCR was performed with Platinum SYBR Green (Invitrogen) according to the manufacturer’s instructions on a LightCycler 480 PCR platform (Roche). The relative gene expression was determined based on the 2−ΔΔCt method.

The sequences of primers used are as follows: CACYBP (forward: 5’-CTCCCATTACAACGGGCTATAC-3’, reverse: 5’-GAACTGCCTTCCACAGAGATG-3’), MYD88 (forward: 5’-GGCTGCTCTCAACATGCGA-3’, reverse: 5’-CTGTGTCCGCACGTTCAAGA-3’), IL6 (forward: 5’-ACTCACCTCTTCAGAACGAATTG-3’, reverse: 5’-CCATCTTTGGAAGGTTCAGGTTG-3’), CXCL8 (forward: 5’-TTTTGCCAAGGAGTGCTAAAGA-3’, reverse: 5’-AACCCTCTGCACCCAGTTTTC-3’), TNF (forward: 5’-CCTCTCTCTAATCAGCCCTCTG-3’, reverse: 5’-GAGGACCTGGGAGTAGATGAG-3’), CX3CL1 (forward: 5’-ACCACGGTGTGACGAAATG-3’, reverse: 5’-TGTTGATAGTGGATGAGCAAAGC-3’), CCL14 (forward: 5’-CCAAGCCCGGAATTGTCTTCA-3’, reverse: 5’-GGGTTGGTACAGACGGAATGG-3’), CCL15 (forward: 5’-TCCCAGGCCCAGTTCATAAAT-3’, reverse: 5’-TGCTTTGTGAGATGTAGGAGGT-3’), CCL16 (forward: 5’-ACAGAAAGGCCCTCAACTGTC-3’, reverse: 5’-TCCTTGATGTACTCTTGGACCC-3’), CCL22 (forward: 5’-ATCGCCTACAGACTGCACTC-3’, reverse: 5’-GACGGTAACGGACGTAATCAC-3’), PPBP (forward: 5’-GTAACAGTGCGAGACCACTTC-3’, reverse: 5’-CTTTGCCTTTCGCCAAGTTTC-3’), CXCL9 (forward: 5’-CCAGTAGTGAGAAAGGGTCGC-3’, reverse: 5’-AGGGCTTGGGGCAAATTGTT-3’), CCL5 (forward: 5’-CCAGCAGTCGTCTTTGTCAC-3’, reverse: 5’-CTCTGGGTTGGCACACACTT-3’), HDAC1 (forward: 5’-CTACTACGACGGGGATGTTGG-3’, reverse: 5’-GAGTCATGCGGATTCGGTGAG-3’), GAPDH (forward: 5’-GGAGCGAGATCCCTCCAAAAT-3’, reverse: 5’-GGCTGTTGTCATACTTCTCATGG-3’).

RNA-Sequencing

Total mRNA was enriched by oligo (dT) beads (Epicentre, USA) and reverse-transcribed into cDNA using random primers. The mRNA was ligated with proprietary 5’ and 3’ adapters. The ligation products were reverse-transcribed by PCR amplification to generate a cDNA library, which was sequenced using an Illumina HiSeq 2500 by Gene Denovo Biotechnology Co. (Guangzhou, China).

Western blotting

The cells were seeded in 6-well plates and treated as indicated. At approximately 70%-80% confluence, the cells were lysed in RIPA buffer (P0013B, Beyotime) containing protease (4693116001, Roche) and phosphatase (4693116,001, Roche) inhibitor cocktails. The concentration of protein was determined by the BCA sample kit (23225, Pierce). After normalization, the protein was boiled in 3 × SDS loading buffer for 10 min. Then 10–20 Sg of protein was subjected to 10%, 12% or 15% SDS-PAGE, transferred to the PVDF membrane (BioRad Laboratories) and blocked with 5% nonfat milk or BSA (23227, Thermo Fisher). The membranes were incubated with primary antibodies at 4 °C overnight, and subsequently with species-specific HRP-conjugated secondary antibodies (31460, Thermo Fisher) at room temperature for 1 h. Enhanced chemiluminescence (WBKLS0100, Millipore) was used to visualize the bands.

Cell fractionation assay

For nuclear and cytoplasmic protein extraction, the cells were seeded in a 6-well plate and were treated as indicated. Then the cells were collected and a protein extraction kit (P0027, Beyotime, China) was used to extract cytoplasmic and nuclear proteins according to the manufacturer’s instructions. Briefly, the cells were washed in precooled 1 × PBS and resuspended in the 200 μL cell lysis buffer (10 mM HEPES, pH = 7.9; 10 mM KCl; 0.1 mM EDTA; 1 mM DTT, 0.4% IGEPAL) containing protease inhibitors. Cell lysates were plated on ice for 15 min and were spun in a microcentrifuge at 4 °C and 14000 rpm for 5 min. The supernatants were collected and stored at -80 °C for analysis when needed. The precipitates were washed and 50 μL nuclear extraction buffer (0.4 M NaCl; 20 mM HEPES, pH = 7.9; 1 mM EDTA; 1 mM DTT; 1 mM PMSF) was added with vigorous shaking on ice for 30 min. The nuclear extracts were aliquoted and stored at -80 °C until use.

Immunohistochemistry

For immunohistochemistry, paraffin-embedded HCC samples were deparaffinized and rehydrated in xylene twice for 15 min and rehydrated by graded ethanol five times for 5 min. After incubation with 3% hydrogen peroxide for 10 min, the sections were boiled in an electric pressure cooker in ethylenediamine tetraacetic acid (EDTA) buffer (pH = 8.0) to retrieve antigen for 2 min. Then the slides were incubated with primary antibodies overnight at 4 °C and secondary antibody (K5007, Dako) at room temperature for 30 min. Signals were detected in freshly prepared DAB substrate solution (K5007, Dako) at room temperature for 5 min and nuclear counterstaining was performed with hematoxylin (C0107, Beyotime) for 1 min. Images were obtained using an automated inverted research microscope (DMI4000, Leica), and each section was evaluated by two independent pathologists blinded to the clinical status of the patients. The area was graded on a scale of 0–4 points (< 25%, 1; 25%-50%, 2; 50%-75%, 3; > 75%, 4) and the intensity was graded on a scale of 0–3 points (no staining, 0; weak staining, 1; moderate staining, 2; strong staining, 3). The product of two values was defined as the final expression score.

Flow cytometry

For M2 macrophage polarization analysis, 100 nM PMA-treated THP-1 monocytes were seeded in a 6-well plate and coculture with or without HCC cells for 48 h. After that, the cells were washed with cold 1 × PBS and incubated with 0.25 μg anti-CD11b in the dark at room temperature for 30 min. The cells were then centrifuged and washed with 1 × PBS twice. Cell fixation and permeability were performed using FIX & PERM Cell Permeabilization Kit according to the manufacturer’s instructions (GAS004, Invitrogen). After that, the cells were incubated with 1 μg anti-CD206 for intracellular staining. After staining, the cells were washed with cold 1 × PBS twice and analyzed using a Beckman-Coulter CytoFLEX LX Flow Cytometer.

ELISA

The cells were seeded in a 6-well plate and transfected with the indicated siRNA for 72 h. Cell culture media were removed and replaced with fresh serum-free DMEM for another 24 h. Then, the supernatants were collected and centrifuged at 10,000 rpm for 10 min. The amount of secreted CX3CL1 was detected using specific ELISA kit according to the manufacturer’s instructions (EK1209-96, Multiscience).

Immunoprecipitation

The cells were harvested in NETN buffer (100 mM NaCl, 20 mM Tris–Cl pH = 8.0, 0.5 mM EDTA, 0.5% IGEPAL) after transfection with plasmids as indicated. After centrifugation at 14,000 rpm for 10 min at 4 °C, the supernatants were incubated with Flag-agarose beads (A2220, Sigma-Aldrich) at 4 °C overnight. After that, the beads were washed five times with NETN buffer and the immunoprecipitates were collected and boiled in 50 μL of 1 × SDS-PAGE loading buffer for 10 min. Finally, the supernatants were analyzed with corresponding antibodies by western blotting.

Immunofluorescence

Cells cultured on 4-well chamber slides (07–2104, Biologix) were fixed with 4% formaldehyde for 10 min and permeabilized with 0.5% Triton X-100 (QLT-100, Jetway Biotech) for 5 min. The cells were blocked with 5% BSA for 30 min at 37 °C, treated with the indicated primary antibodies at 4 °C overnight and incubated with the secondary antibodies conjugated with Alexa Fluor-488 (A11029, Life Technologies) or -594 (A11005, Life Technologies) for 45 min at room temperature. After washing with 1 × PBS, the cells were stained with 50 ng/ml DAPI (P0131, Beyotime) for 5 min at room temperature and evaluated using a Zeiss LSM710 confocal microscope.

Ubiquitination assay

The cells were seeded in a 6-well plate and transfected with the indicated plasmids for 36 h. After that, the cells were harvested using denatured buffer (6 M guanidine-HCL, 0.1 M Na2HPO4, 10 mM imidazole), the cell lysates were incubated with nickel beads (Ni–NTA, R90101, Invitrogen) for 3 h and washed, and the cell extract was analyzed by western blotting.

Proximity ligation assay (PLA)

PLA was performed using the Duolink In Situ Red Starter Kit Mouse/Rabbit (DUO92004, Millipore) according to the manufacturer’s instructions. In brief, the cells were seeded onto an 8-well chamber slide (07–2108, Biologix) at a density of 1 × 104 cells/well overnight, fixed with 4% paraformaldehyde for 10 min at room temperature, washed with 1 × PBS, and permeabilized with 0.1% Triton X-100 for 5 min. The cells were washed with Wash Buffer A, blocked with Duolink Blocking Buffer for 30 min at room temperature, and then incubated with indicated primary antibodies overnight at 4 °C. The next day, the cells were washed repeatedly in Wash Buffer A and incubated with the appropriate Duolink secondary antibodies for 1 h at 37 °C. The ligation and amplification steps of the PLA were performed according to the manufacturer’s protocol. After final washes with Wash Buffer B at room temperature, slides were mounted with Duolink In Situ Mounting Medium with DAPI. Fluorescence signals were imaged using a Zeiss LSM710 confocal microscope.

ChIP assay

ChIP assay were analyzed using a Chromatin Immunoprecipitation Assay Kit (17–295, Millipore) according to the manufacturer’s instructions. Briefly, PLC/PRF/5 cells were transfected with plasmids as indicated for 72 h. The cells were cross-linked with 1% formaldehyde (F8775, Sigma-Aldrich) at room temperature for 10 min and then quenched by glycine addition. After washing, the cells were harvested in the lysis buffer at 4 °C for 30 min and sonicated (Sonifier 450D, Branson)(50% amplitude, 10 s pulse, 30 s rest on ice, 4 cycles) to generate DNA fragments (200–1,000 base pairs in length). A total of 10 μg protein-DNA complexes were immunoprecipitated with the indicated antibodies or isotype-matched IgGs. Next, the immunoprecipitated DNA was purified and used for qPCR analysis.

Statistical analysis

Data were presented as mean ± SD, and the results were analyzed using the GraphPad Prism 7.0 (Dotmatics). A chi-square test was employed to analyze the relationship between CacyBP expression and Myd88 expression. The Kaplan–Meier analysis was employed for the survival analysis. Independent t-test was applied to analyze differences between two groups, and one-way analysis of variance (ANOVA) was used for multiple comparisons. The significance of differences was classified as *p < 0.05, **p < 0.01, ***p < 0.001, or ns (not significant).