Mice

C57BL/6J mice were purchased from Charles River Laboratories (Saint Germain sur l’Arbresle, France). Nlrp3flox/floxCD4Cre mice and their littermate controls Nlrp3flox/floxCD4wt mice, Nlrp3flox/floxCD4creERT2 mice and their littermate controls Nlrp3flox/floxCD4wt, OT-II, OT-II and Nlrp3-/-, were bred at the CDTA (Cryopreservation, Distribution, Typage et Archivage animal; Orléans, France), such as Asc-/-, Caspase1-/-, Il1receptor type I-/- and Il18r-/-, IfnγR-/- mice and Rorcfl/flCD4cre (kindly provided by Pr Ryffel - CNRS, Orléans, France), Nlrp3-/- mice (generated and kindly gifted by Pr Tschopp (University of Lausanne), and Rorc-/- mice (purchased from Jackson laboratories - Bar Harbor, USA). C57Bl6 Ly5.1a (referred to hereafter as CD45.1 mice) and OT-I mice (both kindly provided by Pr. Apetoh). The FELASA and the Animal Experimental Ethics Committee of the University of Burgundy, France, Guidelines were followed for the breeding and use of the animals. Six- and 10-week-old mice were used in the experiments.

T-cell purification, in vitro differentiation and treatment

Mouse naïve CD4+ T cells (CD4+CD44−) obtained from the spleens and lymph nodes of the mice were purified via a MACS cell separation system (naïve CD4+ cell isolation kit, Miltenyi Biotec). The purity of the isolated naïve T-cell population consistently exceeded 95%. Naïve CD4+ T cells were activated with plate-bound antibodies against CD3 (145-2C11, 2 mg/ml) and anti-CD28 (PV-1, 2 mg/ml) in the presence of specific cytokines for different T-cell lineages: 10 ng/ml of IL-12; 10 µg/ml anti-IL-4 antibody (11B11, BioXcell) for Th1; 10 ng/ml of IL-4; 10 µg/ml anti-IFNγ antibody (XMG1.2, BioXcell) for Th2; 4 ng/ml of TGF-β1; 10 µg/ml anti-IL-4 and 10 µg/ml anti-IFNγ antibodies for Treg; 2 ng/ml of TGF-β; 20 ng/ml of IL-6 and IL-1β; and 25 ng/ml of IL-23 for pTh17; and 20 ng/ml of IL-6 and 2 ng/ml of TGF-β1 for Th17r differentiation. TGF-β3 and IL-6 were also used to induce alternative pTh17 cells. Cytokines were obtained from Miltenyi Biotec. The cells were cultured in RPMI-1640 medium supplemented with 10% (vol/vol) fetal bovine serum (FBS) supplemented with nonessential amino acids (MEM-NEAA), sodium pyruvate, penicillin‒streptomycin/amphotericin B (PSA), and 4 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES).

In the cases described in the text, the cells were pretreated for 1 h before stimulation (or as described in the text if different): LPS (1 µg/ml, Sigma‒Aldrich), ATP (5 mM, Fisher Scientific), Z-VAD (50 µM, Selleckchem), Z-IETD-FMK (50 µM, Selleckchem), MCC950 (10 µM, Merck), anakinra (300 nM, MedChemExpress), 4-hydroxy tamoxifen (1 µM, Sigma Aldrich), SIS3 (10 µM, Merck), LY294002 (325 nM, Selleckchem), SB203580 (10 µM, Selleckchem), Y27632 (10 µM, Seleckchem), JNK Inhibitor II (10 µM, Merck), anti-IFNγ antibody (10 µg/ml, XMG1.2, BioXcell) or recombinant mouse IFNγ (research grade, Miltenyi).

Flow cytometry

To analyze cells from lymphoid organs (spleen, lymph nodes, and thymus), the organs were dissociated through a 70 µm strainer, washed with PBS, and then labeled.

To analyze TILs, the tumors were cut into small pieces (<0.5 mm) and dissociated via a tumor dissociation kit and a gentleMACS Octo dissociator (Miltenyi). The lysates were filtered through 70 µm strainers and washed with PBS. CD45+ cells were then enriched via CD45 TIL microbeads for mice and magnetic columns (Miltenyi Biotec). After centrifugation, the cell suspensions were incubated for 3 h at 37 °C in RPMI supplemented with 0.2% stimulation cocktail (Cell Stimulation Cocktail plus protein transport inhibitors ref. 00-4975-93 eBioscience). For tumor dissociation, lymphoid organ isolation or culture, the cells were labeled with antibodies against membrane proteins in flow cytometry staining buffer (ref. 00-4222-26 eBioscience). The antibodies used were CD4-V500 (clone RM4-5, BD), CD4-BUV395 (GK1.5, BD), CD45-BUV395 (30-F11, BD), CD45-Viogreen (REA737, Miltenyi), CD8a-PercP-Cy5.5 (53-6.7, BD), CD8a-BUV805 (53-6.7, BD), CXCR3-APC (REA724, Miltenyi), CCR4-PE-Cy7 (2G12, Biolegend), CCR6-BV605 (29-2L17, Biolegend), CD25-AF700 (PC61, Biolegend), CD25-BV (3C3, BD), CD127-BV605 (A7R34, BD), CD39-PE-Cy7 (24DMS1, eBioscience), CD73-PE (TY/11.8, Biolegend), CD45.2-FITC (104, BD), CD44-V450 (IM7, BD), CD62L-BV786 (EL14, Biolegend), and CD107a-PercP-Vio700 (eBio) Then, the fixation and permeabilization of the cells were performed via FoxP3 staining buffer from Miltenyi followed by intracellular staining. The antibodies used were IL-17-APC (51-7177-82, ebBioscience), IL-17-BUV395 (TC11-18H10, BD), IFNγ-BV421 (XMG1.2, Biolegend), Foxp3-PercP-Cy55 (FJK-16s, eBioscience), Foxp3-PE (FJK-16S, Invitrogen), RORγt-APC (AFKJS-9, eBioscience), Ki67-BV605 (16A8, Biolegend), Granzyme B-FITC (REA226, Miltenyi), TNFα-BV510 (MP6-XT22, Biolegend), STAT1pY701-PE (REA159, Miltenyi), STAT3pY705-FITC (13A3-1, Biolegend), pSMAD2/3-PE-CF594 (O72-670, BD), Helios-APC (22F6, Biolegend), and NLRP3-APC (768319, Fisher). All staining included viability staining (Fixable Viability stain, BD). The stained samples were acquired on a Fortessa cytometer (BD), and analyses were performed via FlowJo software (Tree Star, Ashland, OR, USA). Cell sorting was performed with an ARIAII device (BD).

Cytokine, ATP, AMP, and glycolysis measurements

Secreted cytokines, including IL-1β, IL-18, IFNγ, IL-10, and GM-CSF, were measured via ELISA following the manufacturers’ instructions (BD Biosciences).

For ATP/AMP and glycolysis measurements, the cells were placed in RPMI medium without phenol red (Seahorse XF RPMI, Agilent) supplemented with 10 mM glucose (Seahorse XF Glucose, Agilent), 1 mM pyruvate (Seahorse XF Pyruvate, Agilent) and 2 mM L-glutamine (Seahorse XF L Glutamine, Agilent). For ATP/AMP measurement, the Promega CellTiter-Glo Luminescent Cell Viability assay was used. For glycolysis measurement, the cells were seeded in 96-well test cartridges (Seahorse XF sensor cartridge, Agilent) and centrifuged. Rotenone/antimycin and 2-DG were added to the cartridge according to the manufacturer’s recommendations. The cartridge was then analyzed via the Seahorse XFe96 Analyzer through the Seahorse Glycolytic Rate Assay.

Cell lines, tumors, and treatments

The J774A.1 cell line (used as a macrophage), B16F10 and LLC1 cell lines obtained from ATCC and B16-OVA kindly provided by Pr Apetoh were maintained at 37°C under 5% CO2 in DMEM with 10% FBS supplemented with PSA and 4 mM HEPES.

To induce subcutaneous tumors, 3.105 tumor cells were implanted. Tumor size was regularly monitored every 3 days via a caliper.

For the tumor lung experiments, 2.105 B16-OVA melanoma cells were injected intravenously. Lung tumor foci were counted 13 days after injection.

In some experiments, the following blocking antibodies were administered intraperitoneally (ip) 3 times a week at a dose of 200 µg per mouse: anti-IL-4 (clone 11B11), anti-CD8 (clone YTS169.4), anti-NK1.1 (clone PK136), anti-CD25 (clone PC-61.5.3), anti-TNFα (clone XT3.11), anti-IFNγ (clone XMG1.2) or IgG1 (clone MOPC-21).

Clodronate liposomes, a macrophage inhibitor, were used at 1 mg/mouse, and MCC950, an NLRP3 inhibitor (Merck), at 30 µg/mouse was injected ip twice a week. Digoxin, an RORγt inhibitor (Tocris), was used at 20 µg/mouse per day i.p. Tamoxifen (4 mg/mouse, Bertin Bioreagent) was diluted in sunflower oil and administered daily via oral gavage for 5 days, with pure oil used as a control.

For adoptive transfer experiments, CD4+ T lymphocytes were differentiated as previously described. A total of 2.106 cells were injected per tumor-bearing mouse.

RNA sequencing

Total RNA from T cells was extracted via TRIzol (Invitrogen, Carlsbad, CA, USA). rRNA was removed via the NEBNext rRNA depletion Kit (NEB, Ipswich, MA, USA). One hundred nanograms of rRNA-depleted RNA was used for library preparation via the NEBNext Ultra II Directional RNA library prep kit for Illumina (NEB) following the manufacturer’s instructions. RNA sequencing was performed on a NextSeq500 device (Illumina, San Diego, CA, USA). The RNA-seq libraries were sequenced with 76 bp paired-end reads. Kallisto software was used to quantify transcript abundance from RNA-seq data against the mm10 version of the Mus musculus reference genome. Only protein-coding transcripts and genes were included in the downstream analysis. Differential expression analysis was performed via the DESeq2 R package. The RNA-seq data generated in this study have been deposited in the Gene Expression Omnibus (GEO) database. All other data needed to evaluate the conclusions in the paper are presented in the paper.

Quantitative PCR analysis

For unfixed cells, total RNA was extracted via TRIzol (Invitrogen, Carlsbad, CA, USA). For fixed cells, RNA was extracted via the Maxwell RSC RNA FFPE Kit (Promega). Quality control was performed via the Agilent RNA ScreenTape Assay on a Tapestation 4200 device (Agilent Technologies). Only RNA with a RIN score of 8 or higher was considered suitable for further analysis. For all the experiments, 300 ng of RNA was reverse-transcribed into cDNA by M-MLV reverse transcriptase, random primers, and RNaseOUT inhibitor (Invitrogen). cDNAs were quantified via real-time PCR with a SYBR Green real-time PCR kit (Applied Biosystems) on a Fast7500 detection system (Applied Biosystems, France). Relative mRNA levels were determined via the 2-ΔΔCt method relative to those of β-actin.

Killing assay and immunosuppressive assay

To assess Th17 cytotoxicity, killing assays were conducted using Th17 cells differentiated for 3 days from either OTII or OTIINlrp3-/- naïve CD4 T cells in the presence of TGF-β and IL-6. These cells were plated in 24-well plates with B16-OVA cells at decreasing ratios of B16-OVA/Th17 for 24 h. Cell viability was determined by flow cytometry after Viab and CD4 staining.

To evaluate CD8+ cytotoxicity, killing assays were performed with CD8+ T cells isolated from B16F10 tumors from CD4Nlrp3-/- mice and their littermate controls. The cells were seeded in 24-well plates with B16F10 cells at a 1/1 ratio. Cell death was assessed by flow cytometry through Annexin V/DAPI staining.

Th17 activity was assessed through immunosuppressive assays. Total CD8+ cells were obtained from the spleens and lymph nodes of OTI mice via CD8a (Ly-2) microbeads (Miltenyi). CD8+ cells were cocultured with increasing quantities of Th17 cells differentiated in vitro from OTII or OTIINlrp3-/- naïve CD4+ T cells as previously described in complete RPMI supplemented with the SIINFEKL peptide (2 µg/ml—eBioscience). After 24 h of culture, the cells were harvested, and cytokine production was analyzed via flow cytometry.

Immunofluorescence (IF) and in situ proximity ligation assay (PLA)

A total of 1 × 106 cells were washed, fixed for 10 min at RT with 4% PFA, and permeabilized for 10 min on ice with 100% glacial methanol. Nonspecific binding was blocked at RT for 1 h with a solution containing 5% FBS and 0.3% Triton X-100 in PBS (for IF). The samples were incubated overnight at 4 °C with primary antibodies (1/100 anti-NLRP3/NALP3, mAb, Cryo-2, Adipogen; 1/50 Smad3 Antibody, Cell Signaling Technology; 1/100 phospho-SMAD3 (Ser423/425), 1/50 anti-TGFβ Receptor Antibody type I, Sigma Aldrich; mouse IgG Isotype Control, Thermo Fisher Scientific; Rabbit IgG Isotype Control, Thermo Fisher Scientific) diluted in a solution of 1% BSA and 0.3% Triton X-100 in PBS. The cells were then washed twice with 0.05% Tween 20 in PBS (PBS-Tween).

For IF, the cells were incubated for 1 h at RT with the secondary antibody diluted in the same buffer. The cells were washed twice with PBS-Tween solution and twice with ultrapure water.

For PLA, the cells were incubated for 30 min at 37 °C with the appropriate probes (Duolink® In Situ PLA® Probe Anti-Rabbit PLUS and Anti-Mouse MINUS; Sigma Aldrich) and for 1 h40 with the polymerase solution following the manufacturer’s recommendations.

For both experiments, stained cells were placed onto microscopy slides (Superfrost Ultra Plus®, Thermo Fisher Scientific) and incubated at RT until the water evaporated. The slides were mounted with a drop of mounting medium containing DAPI (Molecular Probes). Slides were imaged via an Axio Imager—M2 microscope (Zeiss). Images were analyzed by Zen software.

Western blot and immunoprecipitation assays

Protein extracts were prepared by lysing cells in boiling buffer (1% SDS, 1 mM sodium vanadate, 10 mM Tris [pH 7.4]) in the presence of complete protease inhibitors (Roche diagnostics) for 10 min at 4 °C. The viscosity of the samples was reduced by sonication. The protein concentration was measured via a Bio-Rad DC protein assay kit. Protein lysates were incubated in loading buffer (125 mM Tris-HCl [pH 6.8], 10% β-mercaptoethanol, 4.6% SDS, 20% glycerol, and 0.003% bromophenol blue), heated at 95°C for 5 min, separated by sodium dodecyl sulfate gel electrophoresis (SDS‒PAGE) and electroblotted to nitrocellulose membranes (Schleicher and Schuell). After incubation for 1 h at RT with 5% nonfat milk or BSA in Tris-buffered saline (TBS)-0.1% Tween 20, the membranes were incubated overnight with primary antibody diluted in 5% nonfat milk or BSA in TBS-Tween, washed, incubated with secondary antibody for 45 min at RT, and washed again before analysis with luminol reagent (Santa Cruz Biotechnologies, Heidelberg, Germany).

The mouse monoclonal anti-NLRP3 (Cryo2) antibody was purchased from Adipogen (Liestal, Switzerland); the Smad3 antibody was from Cell Signaling Technology; the phospho-SMAD3 (Ser423/425) and anti-TGFβ receptor type I antibodies were from Sigma Aldrich; the TGF beta receptor 2 (E-6) antibody was from Santa Cruz; and the SARA polyclonal antibody was from Clinisciences. Monoclonal mouse anti-β-actin (A1978) was purchased from Sigma‒Aldrich.

Immunoprecipitation assays were performed with at least 1.107 cells, as previously described [78].

Chromatin immunoprecipitation assay

Chromatin shearing was performed via a truChIPTM Chromatin Shearing Kit (Covaris) with a focused ultrasonicator M220 device (Covaris). The chromatin immunoprecipitation (ChIP) assay was carried out with a ChIP-IT kit (Active Motif Europe, Rixensart, Belgium) following the manufacturer’s instructions; 1 µg of pSMAD3 antibody (Ser423/425, C25A9, Cell Signaling Technology) or 1 µg of rabbit negative control immunoglobulin G (IgG) was used. DNA precipitation was evaluated via qPCR via the following primers: Ifng 5′ccttgggtgtgttgagtgaa3′ and 5′aaaaagccaatgtggtgagg3′, csf2 5′ggctactcccatttgactgc3′ and 5′cagcctcagagacccaggta3′, Tnfa 5′agggtctgggccatagaact3′ and 5′ccaccacgcttctgtctac3′.

Statistical analysis

The results are shown as the means ± SDs or SEMs, and the data were compared via the Mann‒Whitney test (test group versus control group) or two-way ANOVA when appropriate. Differences in the number of tumor foci were assessed via one-way ANOVA according to group number. Statistical calculations were performed via GraphPad Prism. All other p values were two-tailed. p  <  0.05 was considered statistically significant for all experiments.