Construct components

LB, T-DNA left border; RB, T-DNA right border; Tnos, nos terminator from Agrobacterium; Bar, bialaphos resistance gene as a selection marker gene; UbiP, maize ubiquitin promoter; loxP, site specific recombination site; B1-Peru, Maize pigment synthesis gene used as a visible marker; 5′ TE, 5′ Terminal Inverted Repeat plus subterminal sequence (265 bp) of Ds element; 3′ TE, 3′ Terminal inverted repeat sequence plus subterminal sequence (250 bp) of Ds element.

Description

DRDs (Fig. 1), the ‘Direct Repeat Ds’ T-DNA construct has the 3′ and 5′ TIRs (red and green triangles, respectively) of Ds cloned in direct orientation with reference to each other. The bialaphos resistance selection marker Bar (with Ubi promoter and Tnos terminator) is cloned between the two direct repeats. A visible selection marker gene B1-Peru (with Ubi promoter and Tnos terminator) is placed flanking the 5′TIR. The site-specific recombination site loxP is included between the Ubi promoter and the B-Peru gene.

Fig. 1

Diagram of the DRDs construct; the elements of the transgene construct are noted. Between the Right and Left Border of the Agrobacterium construct are the Ubiquitin Promoter (UbiP) driving the bialaphos resistance gene (BAR) with the Nos terminator (Tnos). This gene is flanked by direct repeats of Dissociation (red and green arrows). The other gene has a ubiquitin promoter followed by a loxP site and then the B-Peru gene terminated with the Nos terminator

Construction of DRDs

The multiple cloning site of T-DNA pPZP201 was removed by cutting with HinDIII and EcoRI and replaced with the following polylinker: AAGCTA-KpnI-XhoI-HinDIII-XbaI-BamHI-SacI-AvrII-XmaI-SpeI-CAATTC. This construct is pZP1718. The following fragments were sequentially introduced into the pZP1718 Multiple Cloning Site (MCS):

Source of DNA fragments

The 3′ TIR and 5′ TIR of Ds are derived from pWL117 [29]. UbiBARTnos and Ubi are derived from pAHC20 [8]. B1-peru [25] was cloned into pBKS.

Sequence of oligos for the the polylinker

PL17

5′AGCTAGGTACCAAAAAAACTCGAGAAGCTTAAAAAAATCTAGAGGATCCAAAAAAAGAGCTCCCTAGGAAAAAAACCCGGGAAAAAAAACTAGTC-3′

PL18

5′AATTGACTAGTTTTTTTTCCCGGGTTTTTTTCCTAGGGAGCTCTTTTTTTGGATCCTCTAGATTTTTTTAAGCTTCTCGAGTTTTTTTGGTACCT-3′

A detailed map of DRDs is shown in Fig. S1.

TransformationMedium formulations

In our experiments, N6 salts mainly have been used in Hi-II callus induction during tissue culture in Agrobacterium-mediated transformation procedures, including infection, co-cultivation, and selection media. MS based media was used in the stage of regeneration. For a complete list of media reagents see Lee and Zhang [18].

Agrobacterium culture initiation and inoculation

Agrobacterium tumefaciens strain EHA101 glycerol stock was removed from a  − 80 °C freezer and streaked onto a YEP medium plate containing appropriate antibiotics. Then, the plate was incubated at 28 °C for 2 to 3 days in the dark until bacterial colonies developed fully.

One full loop of EHA101 from a YEP plate was suspended with 5 ml of sterile PHI-A infection medium in a 15 ml Falcon tube. 1 ml of such suspension was transferred to a spectrophotometer cuvette and the cell density was checked of the suspension culture at λ = 550 (OD550). The value of OD550 should be between 0.3 and 0.4.

Maize immature embryo dissection

F2 immature zygotic embryos were obtained from maize Hi-II hybrid (F1) crossed by Hi-II A or Hi-II B line. After 9 to 12 days post self-pollination, ears were collected when the size of immature embryos was approximately 1.5–2 mm in length and sterilized with a solution consisting of 50% commercial bleach containing 5.25% sodium hypochlorite in autoclaved water with 2 drops of TWEEN 20 to cover the ears for 20 min at room temperature. The bleach solution was poured off and the ears washed with autoclaved water three times for 5 min each. Then, the top half of the kernels of each ear were cut off. The 1.5 to 2 mm embryos were removed and placed into a 2 ml microcentrifuge tube filled with infection medium. The embryos were washed with the same medium three times.

Agrobacterium infection and resistant culture selection

1 ml of Agrobacterium suspension was added into each 2 ml tube. After 5 to 10 min with the embryos submerged, the Agrobacterium suspension was poured off and the embryos placed onto co-cultivation medium plates. The embryos were placed flat face down on the medium using a spatula. Then, the plate was incubated at 20 °C in the dark for 3 days. Subsequently, embryos were transferred to the callus induction medium plate and placed in a 28 °C incubator in the dark for 10–12 days. Embryos were then sub-cultured on callus selection medium I for 2 weeks for initial herbicide selection. Next, these calli were moved to callus selection medium II plates and were sub-cultured to fresh selection medium II biweekly until all remaining herbicide resistant calli proliferated. Each callus from the same embryo was treated as a single transformation event.

Regeneration of transgenic plants

The herbicide-resistant calli were cultured on regeneration medium in a 28 °C incubator to initiate shoots and sub-cultured to the same medium biweekly until shoots are visible. Then, the shoots were moved to rooting medium and cultured at 25 °C under 16:8 h photoperiod with light intensity of 100–150 µmol m−2 s−1. After 2–4 weeks, each regenerated small plantlet was transferred to small pots containing Pro-mix soil and allowed to acclimatize for 2–3 weeks in growth chamber conditions at 25 °C under 16:8 h photoperiod with light intensity of 300 µmol m−2 s−1. Finally, these transgenic plants were transplanted to the greenhouse.

Fluorescence in situ hybridization

Fluorescence In Situ Hybridization (FISH) was conducted as described [2, 16] with the following modifications. To facilitate probe production, the HindIII fragment of DRDs was cloned into pBlueScript (Agilent, Santa Clara, CA, USA). A Texas-Red labeled DRDs probe (NEL426001EA, PerkinElmer-Revvity, Waltham, MA, USA) was made via nick translation [15] using either plasmid DNA or PCR product [Primers, M-13 Forward (5′-GTAAAACGACGGCCAGT-3′) and M-13 Reverse (5′-CAGGAAACAGCTATGAC-3′); enzyme, JumpStart REDTaq Ready Mix (P0982, Sigma-Aldrich, St. Louis, MO, USA)]. To identify each chromosome pair, two fluorescent oligonucleotides (Integrated DNA Technologies, Coralville, IA, USA) were used in conjunction with DAPI (4′,6-diamidino-2-phenylindole) incorporation into heterochromatic regions. Sequence of the Centromere C (Cent C) oligo is 5′- 6-FAM / CCTAAAGTAGTGGATTGGGCATGTTCG-3′. The TAG microsatellite repeat oligo is a 56-mer, sequence 5′- 6-FAM / AGT- (AGT)17—AG-3′. The hybridization mixture (for 10 µL/slide) contained 200—400 ng DRDs probe, 45 ng Cent C oligo, and 10 ng TAG oligo in 2X SSC – 1 X TE buffer [15]. Images were captured with a Cool-1300QS CCD camera (VDS Vosskühler GmbH, Osnabrück, Germany) on an Olympus BX61 fluorescence microscope (Olympus Corporation, Tokyo, Japan) using GenASIsis software (Applied Spectral Imaging, Carlsbad, CA, USA). Images were processed using the Curves, Levels, and/or Brightness-Contrast functions of Photoshop 2023 (Adobe, Inc., San Jose, CA, USA).