Reagents and antibodies

Bleomycin hydrochloride (HY-17565A), (E)-SIS3(HY-13013), SB-431542 (HY-10431), RGFP966 (HY-13909) and cycloheximide (HY-12320) were purchased from MedChemExpress (Shanghai, China). Antibodies against HDAC3, Collagen 1, TGF-β1, α-SMA, E-cadherin, N-cadherin, Vimentin, KLF4, HIF-1α, GATA3, c-Jun, BRD4, pan acetyl-lysine, IgG, ABCA3, CD206, HDAC2, HDAC4, SIRT3, EpCAM and GAPDH were provided by ABclonal (Wuhan, China). Antibodies against SMAD3 and phosphorylated (P)-SMAD3 were purchased from Cell Signaling Technology (Danvers, MA, USA). Secondary antibodies against HRP-conjugated AffInipure Goat Anti-Rabbit IgG (H + L), HRP-conjugated AffInipure Goat Anti-Mouse IgG (H + L) Cy3-conjugated AffInipure Goat Anti-Rabbit IgG (H + L) and FITC conjugated AffInipure Goat Anti-Rabbit IgG (H + L) were purchased from Proteintech Group, Inc (Wuhan, China). HDAC3 plasmid, SMAD3 mimic and negative control were obtained from GenePharma Co.,Ltd (Shanghai, China). QuickMutation™Plus Site-Directed Mutagenesis Kit, Dual-Lumi™Luciferase Reporter Gene Assay Kit and Immunoprecipitation Kit with Protein A + G Agarose Gel were provided by Beyotime Biotechnology (Shanghai, China). SMAD3 adenovirus was purchased from Hanheng Biotechnology (Shanghai) Co., Ltd. Other general chemical reagents were purchased from Sinopharm Chemical Reagent Co., Ltd (Shanghai, China).

Human samples

We collected lung tissue samples from six male patients who were diagnosed with IPF and underwent lung transplantation at Renmin Hospital of Wuhan University. Lung tissues around the pulmonary bulla from six male patients < 20 years old were collected as healthy controls. A part of each fresh lung tissue sample was fixed with paraformaldehyde for histological analysis, and the remaining part was frozen at − 80 ℃ for molecular biology analysis. This study was approved by the Clinical Research Ethics Committee of Renmin Hospital of Wuhan University (WDRY2022-K207). All subjects gave informed consent.

Animals and treatment

All animal experiments were approved by the Laboratory Animal Welfare & Ethics Committee of Renmin Hospital of Wuhan University (20221205A). All the mice were kept in the Animal Center of Renmin Hospital of Wuhan University in a specific pathogen-free (SPF) barrier system with a humidity of 45–55% and a temperature of 20–25 °C on a regular 12 h light/dark cycle. All animal experiments were conducted at the Animal Center of Renmin Hospital of Wuhan University. C57BL/6 mice were obtained from the Hubei Provincial Center for Disease Control and Prevention. (Wuhan, China). HDAC3flox/− mice were purchased from Shanghai Model Organisms Center, inc. (Shanghai, China). Sftpc-CreERT2( ±) and transgenic mice were purchased from GemPharmatech Co., Ltd (Jiangsu, China). To generate AT2 cell-specific HDAC3-deficient (HDAC3-CKO) mice, Sftpc-CreERT2( ±) mice were crossed with HDAC3flox/− mice. Littermate HDAC3flox/floxSftpc-CreERT2(-/-)(HDAC3-C) mice were used as controls (Additional file 1: Figure S2).

Tamoxifen treatment was administered to induce the deletion of HDAC3 in AT2 cells, HDAC3-CKO mice were administered intraperitoneal (IP) injections of 100 mg/kg/day tamoxifen (TAM, Sigma-Aldrich) diluted in absolute ethanol and corn oil (Sigma-Aldrich; v/v 1:9) for 5 days. The HDAC3-C mice were treated the same way. To establish a pulmonary fibrosis model in vivo, the mice were given intratracheal injection of bleomycin(2.5 mg/kg) dissolved in 50 μl sterile saline as previously reported [33]. The control group was administered the same volume of sterile saline via the trachea. Of note, for the HDAC3-CKO mice, bleomycin was administered immediately after the last tamoxifen-treatment. For RGFP966 treatment, RGFP966 (10 mg/kg body weight) was administered by intraperitoneal injection after BLM stimulation [15]. The mice were euthanized on days 0, 7, 14 and 21. Specifically, the mice were sacrificed by cervical dislocation at the end of the experiment under deep anesthesia with 0.3% pentobarbital sodium. The right lung was quickly taken out and frozen at − 80 ℃ for molecular biological analysis. The intact left lung was dissected and perfused with paraformaldehyde through the trachea for histological analysis.

Isolation and culture of EpCAM-positive and negative cells

Briefly, after euthanasia, the neonatal mice were soaked in 75% ethanol and disinfected for 5 min. In a sterile state, cut open the chest cavity layer by layer, cut off the entire lung, and wash the blood on the surface of the lung tissue with sterile PBS solution. Then cut the lung tissue into 1 mm3 sized tissue blocks and place them in a 10 ml centrifuge tube. Add 6 ml of 0.2% collagenase and digest at 37 °C for 1 h. Then add 4 ml of 0.5% trypsin and digest for 30 min. Centrifuge at 4 °C for 5 min (1500r/min) and discard the supernatant. Add 5 ml of Ham's F-12 K culture medium containing 10% FBS to terminate digestion, blow evenly, filter the cell suspension with a 74 μm well metal filter, and adjust the cell concentration to (2 ~ 3) × 106 cells/ml. Pre coat EpCAM antibody in cell culture dishes. Plant the cell suspension in the culture dish and incubate it at 37 °C for 6 h. The cells adsorbed in the dish are EpCAM-positive cells, and the supernatant is EpCAM-negative cells.

The extracted EpCAM-positive cells were cultured at 37℃ and 5% CO2, with 10% FBS + Ham’s F-12 K; EpCAM-negative cells were cultured at 37℃ and 5% CO2, with 10% FBS + PRMI-1640.

Isolation and culture of AT2 cells

Neonatal mouse primary AT2 cells were isolated by membrane filtration and immune-adhesion [34]. Firstly, after euthanasia, the mice were disinfected with alcohol and the lung tissues were removed and digested with trypsin and collagenase, and red blood cell lysis buffer was added to remove red blood cells. Next, preliminary isolation was performed according to the size of the cells. AT2 cells were about 10 μm smaller than macrophages (about 25 μm) and AT1 cells (50-100 μm). Large tissue debris was removed by primary filtration through a 74 μm membrane. All AT1 cells and some macrophages were removed by subsequent filtration through a 38 μm membrane. Finally, a filter membrane with a pore size of 19 μm was used for further fine filtration. The filtrate was purified by immune-adhesion. A plastic plate was coated with IgG, and the cell suspension was placed on the plate. This technique causes macrophages and most other non-AT2 cells to bind to the IgG due to their Fc fragment-containing receptors, and become adsorbed to the plate. In contrast, non-adherent AT2 cells are washed down to obtain AT2 cells with high purity. AT2 cells extracted from HDAC3flox/flox mice were labeled as HDAC3-CAT2, and AT2 cells extracted from HDAC3-CKO mice were labeled as HDAC3-CKOAT2.

The extracted AT2 cells were cultured at 37℃ and 5% CO2, with 10% FBS + Ham’s F-12 K for 72 h, during which the growth state and cell morphology were quantified (Additional file 1: Figure S8). The HDAC3 selective inhibitor RGFP966 (15 μM), TGF-β1 (10 ng/ml), inhibitor of TGF-β receptor type I (TGF-βRI) SB-431542 (5 μM) and inhibitor of SMAD3 phosphorylation SIS3 (10 μM) were added at the appropriate time.

Bioinformatics analysis of HDAC3 expression in human AT2 cells

The GSE86618 dataset, which comprises single-cell transcriptomic datasets of AT2 cells isolated from healthy individuals or patients with IPF, was analyzed [35].In addition, the GSE180415 dataset, which comprises RNA sequencing datasets of lung fibroblasts isolated from healthy individuals or patients with IPF, was also analyzed. The preprocessed table with normalized expression measurements was downloaded using the GEOquery package [36] within the R statistical programming environment. Differences between groups were analyzed for statistical significance by non-parametric Wilcoxon signed-rank test and were visualized as scatter plots.

Histopathological analysis

The left lung was fixed with paraformaldehyde, paraffin embedded and sectioned, dewaxed and hydrated, and then dehydrated and sealed after being stained with hematoxylin and eosin (H&E).

Next, Masson’s trichrome staining was performed as follows: the sections were dewaxed and incubated in methyl dichromate overnight, and then stained with iron hematoxylin, ponceau red acid fuchsin, phosphomolybdic acid and aniline blue in turn. Finally, the sections were dehydrated and sealed for microscopic examination.

Picrosirius red (PSR) staining was also conducted. Briefly, sections were placed in xylene I for 20 min. followed by xylene II for 20 min, absolute ethanol I for 5 min, absolute ethanol II for 5 min, and finally 75% alcohol for 5 min. After washing with tap water, the sections were stained in Sirius red dye for 8 min, dehydrated and sealed, and observed under the microscope.

The severity of interstitial fibrosis was assessed in a blinded fashion by two researchers using the Ashcroft scoring system [37].

Immunohistochemistry

Immunohistochemical analysis was performed as previously described [38]. Briefly, 3 μm-thick paraffin sections of mouse lung were prepared, followed by dewaxing, hydration, blocking, antigen retrieval, and further blocking with 5% BSA for 30 min at room temperature. Then, slides were incubated overnight with an appropriate concentration of primary antibody at 4 ℃. After washing with PBS three times, the secondary antibody was added and incubated at 37 °C for 60 min. After washing again with PBS, DAB was added for 5–10 min, and samples were rinsed with tap water for 5 min. The expression of corresponding protein in lung tissue was observed and captured by microscopy. ImageJ software was used to quantify protein abundance.

Immunofluorescence

ABCA3 is a specific marker of AT2 cells [39]. First, 3-μm paraffin sections of lung tissue were prepared and subjected to dewaxing, hydration, antigen retrieval, and washing with PBS, before incubating in primary antibody (anti-ABCA3, 1:50, purchased from Abcam in Cambridge, #ab32369; anti-HDAC3, 1:50, purchased from Abcam in Cambridge, #ab99856) overnight at 4 °C. The next day, slides were rewarmed and washed again with PBS, and then incubated in secondary antibody for 60 min at room temperature in the dark. Slides were then washed again in PBS and DAPI was added to stain the nuclei, incubating for 30 min at room temperature in the dark. Slides were washed again in PBS and then finally sealed with gum medium for observation under the confocal microscope (Olympus, Japan).

AT2 cells were fixed with 4% paraformaldehyde for 20 min, washed with PBS, and blocked with 5% goat serum for 30 min at room temperature. Then, cells were permeabilized using 0.5% Triton X-100 for 20 min and washed with PBS, and incubated in primary antibody (anti-HDAC3,1:50) overnight at 4 ℃. The next day, samples were rewarmed, washed with PBS, then incubated in an appropriate amount of secondary antibody for 60 min at room temperature in the dark. After washing again with PBS, DAPI was added to stain the nuclei, followed by washing in PBS again and sealing with neutral gum. Samples were observed and images captured using a confocal microscope (Olympus, Japan).

Real-time PCR

Real-time PCR was performed as previously described [40]. After extracting total RNA, reverse transcription was conducted with the following reaction mix: total RNA 2 µl, 5 × Reaction buffer 4 µl, SweScript RT I Enzyme Mix 1 µl, Oligo (dT)18 Primer (100 μM) 1 µl, and DEPC water added to a total volume of 20 µl. The reaction conditions were: 50 ℃ for 20 min and 85 ℃ for 5 s. The PCR reaction system included: SYBR Green Realtime PR Master Mix 10 µl, forward and reverse primers 0.8 µl, cDNA template 2 µl, and ddH2O added to a total volume of 20 µl, The PCR reaction conditions were: initial denaturation at 95 °C for 30 s, then 40 cycles of (95 °C for 5 s, 60 °C for 10 s, 72 °C for 15 s). The cycle threshold (CT) value was determined and the 2−△△CT method was used to calculate the relative expression of mRNA. PCR primer sequences are shown in Table 1.

Table 1 The primers used in real-time PCRWestern blot

Western blotting was performed as previously described [41]. Briefly, murine lung tissue or AT2 cells from the experimental interventions described above were treated with lysis buffer, placed in an automatic homogenizer on ice for 30 min, and fully lysed. After centrifugation at 4 ℃, the supernatant was collected and the protein concentration was measured with a BCA assay kit. Loading buffer was added to the protein samples, which were then boiled to denature the proteins. Samples were immediately cooled, then resolved by SDS-PAGE electrophoresis. After transfer, the membrane was turned, rinsed and blocked. The membrane was then incubated overnight at 4 °C in the appropriate concentration of primary antibody (HDAC3-1:1000, Collagen 3–1:1000, α-SMA-1:1000, E-cadherin-1:1000, N-cadherin:1:1000, Vimentin-1:1000, SMAD3-1:1000, p-SMAD3-1:1000, KLF4-1:1000, HIF-1α-1:1000, GATA3-1:1000, c-Jun-1:1000, BRD4-1:1000, GAPDH-1:5000). The next day, after rinsing, membranes were incubated in secondary antibody for 1.5 h. Membranes were rinsed again and images obtained by chemiluminescence. The gray values of protein expression were analyzed using Image J software as previously described [42].

Nuclear and cytoplasmic protein separation

Nuclear and cytoplasmic proteins were extracted with a nuclear and cytoplasmic protein extraction kit (P0028) (Beyotime Biotechnology, Shanghai, China) according to the manufacturer’s protocol. Proteins were analyzed by western blot.

Coimmunoprecipitation (Co-IP) analysis

Co-IP was performed using an immunoprecipitation kit and anti-pan acetyl-lysine (Ac-lys) antibody following the manufacturer’s protocol. Target proteins (GATA3 and Ac-lys) in the immunoprecipitants were examined by western blot. Co-IP of IgG was used as a negative control.

Protein degradation assay

To examine the degradation of GATA3 proteins using a pharmacological approach, AT2 cells pre-treated with DMSO or RGFP966 were incubated in cycloheximide (250 μg/ml) for 0, 1, 2, 4, 6, or 8 h and analyzed by western blot for GATA3 expression. For the genetic approach, HDAC3-CAT2 and HDAC3-CKOAT2 were also treated with cycloheximide (250 μg/ml) for 0, 1, 2, 4, 6, or 8 h and analyzed by western blot for GATA3 expression.

siRNA transfection

AT2 cells cultured in Ham’s F-12 K supplemented with 10% FBS were transfected with GATA3 siRNA or negative control siRNA (Sangon, Shanghai, China) using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) as previously described [43]. The transfected cells were then stimulated with murine TGF-β1 (10 ng/ml).

Chromatin immunoprecipitation (ChiP) assays

The base binding sites of SMAD3 and HDAC3 promoter were obtained through the starBase database. The putative SMAD3 binding motif is CAGCGAGCCCAGACATCTCGCTTGA. To verify this hypothesis, SMAD3 was upregulated via Ad-SMAD3 transfection in AT2 cells. Thirty-six hours after transfection, the cells were collected and cross-linked with paraformaldehyde (4%) for 10 min (37℃). Glycine (2 mg/mL) was added to neutralize additional paraformaldehyde followed by cell lysis using an ultrasonic apparatus. Antibodies against SMAD3 and IgG were used for immunoprecipitation. Immunoprecipitated DNA was used as a template for real time quantitative PCR reactions. At the same time, the amplified DNA was subjected to agarose gel electrophoresis to detect binding of SMAD3 to the HDAC3 promoter.

Dual-luciferase reporter gene assay

Mouse HDAC3 promoter reporter plasmid (HDAC3p-luc) was constructed in pGL-4-luc plasmid by inserting a PCR-amplified mouse genomic DNA fragment at XhoI and HindIII sites. Then, mutant plasmid (mHDAC3p-luc) in which the SMAD3 responsive element CAGCGAGCCCAGACATCTCGCTTGA was mutated to CAGCGAGCCCAGCACTCTCGCTTGA was generated by QuickMutation™Plus Site-Directed Mutagenesis Kit. Specifically, targeting plasmid template (CAGCGAGCCCAGACATCTCGCTTGA), the mutation primer (forward primer: CAGCGAGCCCAGCACTCTCGCTTGA; reverse primer: GTCGCTCGGGTCGTGAGAGCGAACT) was designed. Next, the primer was configured to 100 μm. Then, the gene site-specific mutation reaction was carried out, and the reaction system proceeded as follows: 10 × BeyoAmp™ Buffer (with Mg2+) 5 ul, forward primer and reverse primer 1 μl each, dNTP mix 5 μl, mutated plasmid 2 μl, BeyoAmp™ Extra-long DNA Polymerase 1 μl, Nuclease-Free Water 35 μl to a total volume of 50 μl. The PCR reaction procedure was as follows: 95℃, 3 min; 95℃, 30 s; 55℃, 30 s; 68℃, 30 s/kb; repeat the above 3 steps for 20 cycles; 68℃, 10 min; 4℃, hold on. Finally add DpnI for digestion. Next, 1 μg HDAC3p-luc / mHDAC3p-luc plasmid and 50 nmol/L SMAD3 mimic/NC plasmid were transfected into 1 × 104 mouse AT2 cells. After 72 h, luciferase activity was calculated using the Renilla luciferase system.

HDAC3 activity assay

For human lung tissue and mouse lung tissue, the supernatant was collected after homogenization and centrifugation. For AT2 cells, RIPA lysate was added and centrifuged to extract the supernatant. HDAC3 activity was examined with a HDAC3 activity assay kit (Sigma, EPI004) according to the manufacturer’s instructions. Briefly, HDAC3 deacetylates the substrate [R-H–K-K (Ac) − AFC] to release AFC, which is fluorometrically detected (Ex/Em = 380/500 nm).

Statistical analysis

All the data in this study were expressed as the mean ± standard error of the mean and analyzed using SPSS 23.0 software. Unpaired Student’s t-test was used for comparisons between two groups. Two-way analysis of variance (ANOVA) without repeated measures was performed for multiple comparisons with two independent variables. One-way ANOVA with Tukey’s post hoc test was used for comparisons among three or more groups. Tukey's tests were run only when F achieved P < 0.05 and homogeneity of variance was satisfied; otherwise, Tamhane’s T2 post hoc test was performed. Normality and homogeneity were tested using Liljefors’ and Levene’s tests, respectively. Statistical significance was set at P < 0.05.