Experimental materials

The human breast cancer cell strains MDA-MB-231 and SUM149PT were purchased from the Shanghai Institute of Cell Biology at the Chinese Academy of Sciences, and lentiviral scrambling vector LV-Emi1-ribonucleic interference (RNAi) and negative-control viral vector LV-Emi1-RNAi were obtained from Shanghai Genechem. Reverse transcription (RT) primers were obtained from GeneRay (CA, USA), and microRNA polymerase chain reaction (PCR) was obtained from Thermo Scientific (MA, USA). Both M-MLV kits and deoxynucleotide triphosphates were obtained from Promega (MA, USA), and MTS cell viability detection kits were obtained from Shanghai Sangon. Lipofectamine™ 2000 was obtained from Thermo Scientific (MA, USA), and TRIzol™ was obtained from Shanghai Pufei. Finally, TaqMan PCR (qPCR) primers were obtained from Shanghai Genechem, and TaqMan PCR kits were obtained from Thermo Scientific (12,574,035, MA, USA).

Experimental methodsTotal RNA extraction

The cell lines MDA-MB-231 and SUM149PT were purchased from the Cell Resource Center, Shanghai Academy of Life Sciences and cultured in Dulbecco’s modified Eagle medium containing 10% foetal serum. After the cell density reached approx. 70–80%, the experimental (KD) group was transfected with a lentiviral vector (LV-Emi1-RNAi) containing an effective interference sequence against Emil. The negative control (NC) group was transfected with Emi1 without effective infection, and the empty control (CON) group was transfected with a chronic viral vector, LV-CON. The cells were subsequently collected. The total RNA was extracted with TRIzol lysate, and the concentration and quality of the RNA were measured using a NanoDrop™ 2000/2000 C spectrophotometer.

Reverse transcription to obtain cDNA

For the microRNA reverse transcription, the primer information was as follows: for the endogenous reference gene GAPDH, the upstream primer sequence was TGACTTCAACAGCGACACCCA, and the downstream primer sequence was CACCCTGTTGCTGTAGCCAAA. The amplified fragment was 121 bp. For the target gene Emi1, the upstream primer sequence was CGAGAAGGCTGTGGATTTGAT, and the downstream primer sequence was ACCAGGCAGGGGACCTATTTT. The amplified fragment was 117 bp. After the primers were prepared, RNA RT and two-step real-time RT-PCR were performed, and a dissolution curve was created.

Design of ribonucleic acid targeting the Emi1 gene

The RNAi lentiviral vector was prepared via synthesis, construction, identification, sequencing and extraction. The siRNA lentiviral expression vector targeting the Emi1 gene included three target sequences as follows: Emi1-RNAi (1): TCGCTGTAATTCACCTGCAAA; Emi1-RNAi (2): CCAGACCAATATCCCAACAAA; and Emi1-RNAi (3): CGGTGTAGTATCCTGAGGTTT. The tool carrier number was GV248, the frame structure was hU6-MCS-Ubiquitin-EGFP-IRES-puromycin, the control number was CON077, and the control insert sequence was TTCTCCGAACGTGTCACGT.

RNAi lentivirus packaging, concentration and purification, titer determination and Infection of target cells

The amount of virus used was calculated. Human breast cancer cells MDA-MB-231 and SUM149PT were inoculated on 12-well plates in accordance with the KD group (LV-Emi1-RNAi, named according to the lentiviral vector containing the effective interference sequence target, Emil), the NC group (without effective Emi1 infection) and the CON group (the chronic viral vector, LV-CON). The cells were kept in an incubator containing carbon dioxide. Lentiviral infection was performed after three days, and the medium was changed after 12 h. The infection efficiency of the virus was observed under a fluorescence microscope. When the fluorescence rate was approx. 70–80% and the confluence rate was approx. 80%, the cells were collected. Next, RNA was extracted 4 days after cell proliferation and infection in each group, and the level of Emi1 mRNA expression in each group was determined.

Real-time quantitative polymerase chain reaction of Emi1 and possible targeted proliferation and invasion-related genes

The LV-Emi1-RNAi virus particles containing the target gene were used to infect the target cells. The fluorescence of the cells was observed using a fluorescence microscope; the infection rate was > 50%. The cells were collected, RNA was extracted and reverse transcribed into cDNA, and the expression of Emi1 mRNA in each group was determined. When detecting the mRNA content of Emi1, the cells were seeded in a 12-well cell culture plate. After 24 h of transfection, the medium was discarded. After washing twice with phosphate-buffered saline, TRIzol lysate was added, and the total RNA was extracted. The RT was conducted with 1-μg RNA, and cDNA was obtained and amplified according to the following procedures.

The reaction mixtures were incubated at 50 °C for 15 min, followed by 95 °C for 5 min; next, 40 PCR cycles were performed with the following temperature profiles: 95 °C for 15 s, 60 °C for 30 s and 72 °C for 1 min; the amplification curve and the number of take-off cycles (Ct) were obtained. The mRNA content was calculated according to 2 − ΔΔCt. TaqMan PCR kits were obtained from Thermo Scientific (12,574,035, the United States). The Platinum Taq enzyme was used. The primer sequence information is as follows: GAPDH: F: TGACTTCAACAGCGACACCCA; R: CACCCTGTTGCTGTAGCCAAA. Emi1: F: CGAGAAGGCTGTGGATTTGAT; R: ACCAGGCAGGGGACCTATTTT. PDCD-4: F: TTGAGCACGGAGATACGAAC; R: GTCCCGCAAAGGTCAGAAAG. FasL: F: GGCCTGTGTCTCCTTGTGAT; R: TGCCAGCTCCTTCTGAAGTA. PTEN: F: TGGATTCGACTTAGACTTGACCT; R: GGTGGGTTATGGTCTTCAAAAGG. RhoB: F: ATCCCCGAGAAGTGGGTCC; R: CGAGGTAGTCGTAGGCTTGGA. Maspin: F: GCCAGGAGCACGGATCCT; R: GTTGTGCCTGATGTAAATAAAGG. TIMP3: F: CAGGTCGCGTCTATGATGGC; R: AGGTGATACCGATAGTTCAGCC. RECK: F: AGTGCGGGTGCATTGTGTT; R: TTCACAGCAGCCTAAGCCAAC.

Western blotting for Emi1 protein level detection

The total protein was extracted from the infected cells; the protein concentration was determined using the bicinchoninic acid assay method, and the protein level of Emi1 was detected using Western blotting (WB), as previously described [7]. The primary antibody (anti-Emi1 antibody) (ab215765, Abcam, Cambridge, UK) was diluted at a ratio of 1:200 and incubated overnight at 4 °C; the secondary antibody (Anti-rabbit IgG, HRP-linked Antibody, #7074, Cell Signaling Technology, MA, USA) was diluted at a ratio of 1:2,500 ~ 3,000 and incubated at room temperature for 1 h. The protein bands were scanned by a computer, and the grey level was analysed by software. The expression rate of Emi1 (Emi1/GAPDH [ratio of grey value])% was determined using GAPDH as an endogenous reference.

Cell viability test

To detect cell viability, the cells were seeded in a 96-well culture plate. After 24 h of transfection, 20 μl of MTS detection solution was added to the culture system. After 4 h of continuous incubation, the culture plate was placed in a microplate reader, and the absorbance (OD) value at a wavelength of 490 nm was measured [8].

Cell invasion detection

To detect cell invasion, the cells were seeded in a Transwell chamber. After 24 h of transfection, the cell plate at the bottom of the chamber was removed and stained with DAPI staining solution. The numbers of cells in three high-power fields were counted under a fluorescence microscope [8].

Statistical methods

The data were recorded and processed using the SPSS 20.0 software. First, the data were tested to see if they corresponded to a normal distribution; if they did, the data between the two groups were analysed by a two-tailed t-test. A P value of < 0.05 indicated that the difference was statistically significant. A nonparametric test was used for non-normal distribution.