Plant material

Five alfalfa plants (stems and leaves) were sampled from each of the four different fields, 10–15 acres in size, located in Yuma Country, Arizona, USA. Geographic coordinates of the alfalfa fields and the adjacent crops are shown in Table 1.

Table 1 Geographic locations of alfalfa fieldsTotal RNA extraction and RNA sequencing

Five leaves were pooled from each of the 20 plants for RNA extraction. Total RNA was extracted using Promega Maxwell® RSC Plant RNA Kit (Promega Corp., Fitchburg, WI) according to the manufacturer’s directions. cDNA libraries were prepared using Illumina TruSeq Stranded Total RNA with the Ribo-Zero Library Prep Kit (Illumina Inc., San Diego, CA USA) and RNA sequencing was performed by Psomagen (Psomagen Inc., Rockville MD USA) on a NovaSeq6000 S4 platform (150PE, 1Gb, 20 million total reads).

Bioinformatic analysis

A schematic representation of the bioinformatics pipeline used in this study is shown in Fig. 1. Briefly, sequence reads were first trimmed using Trimmomatic [16], followed by their assembly with SPAdes [17]. The resulting contigs were screened using BLASTx searches [18] against a virus database containing all plant virus protein sequences from the NCBI RefSeq database (https://www.ncbi.nlm.nih.gov/refseq/). The potential plant viral hits were searched once again using BLASTx against the full NCBI nr protein database. BBMap [19] was used to generate sequencing coverage values for the identified contigs. For the prediction of cleavage sites for viral proteases, polyproteins from 109 different members of the family Potyviridae were aligned by four different Multiple Sequence Alignments (MSA) software applications: ClustalW, ClustalO, MUSCLE, and CLC Genomics Workbench 23, very accurate setting (QIAGEN LLC, Germantown MD USA). Cleavage sites obtained by each MSA method were compared and the most likely sites were selected by another comparison with previously reported consensus sites [20].

Fig. 15’RACE and Reverse transcription–polymerase chain reactions (RT-PCR)

5’RACE was performed with SMARTer RACE 5’/3’ Kit (Takara Bio USA, Inc. San Jose, CA USA) according to the manufacturer’s directions. Gene-specific primers for amplification were LN1074, 5’ GATTATCTGATTGGTTACCACAGAACTGGC 3’ (reverse, pos. 361–390 nt) and LN1115 5’ TGATCTCAAGGTGATTATCTGATTGGTTAC 3’ (reverse, pos. 373–402 nt). Total RNA for RT-PCRs was extracted using TRIzol Reagent and reactions were performed using the SuperScript One-Step RT-PCR System or SuperScript™ III First-Strand Synthesis System following by PCR amplification with AmpliTaq Gold DNA Polymerase under conditions recommended by the manufacturer (Thermo Fisher Scientific Inc., Waltham, MA USA). Negative control reactions were performed with RNA obtained from uninfected N. benthamiana or with sterile RNAse-free water processed for cDNA preparation the same way as RNA extracted from the infected alfalfa plants. Three virus-specific sets of primers were designed based on the results of the HTS analysis: 1) LN1077/LN1078 (forward, 5’ CTCCCTTTGGTACTCGGTATTG, 3′, pos. 7468–7489, and reverse, 5′ CTCTAATGTGCGGACCTTTCT 3′, pos. 7861–7881, size 414 bp); 2) LN1079/LN1080 (forward, 5′ TGACAGCGAGTTCTCATTCC 3′, pos. 8954–8973, and reverse, 5′ GTCAGTCAAACCAGCCTTTATTC 3′, pos. 9589–9611, size 658 bp); 3) LN1095/LN1096 (forward, 5′ CCAGGGTGTTGTTGATGATTTG 3′, pos. 3965–3986, and reverse, 5′ TCTCAGTCACATTCCGCATAAA 3′, pos. 4368–4389, size 425 bp). PCR products were either sequenced directly or cloned into the TOPO II vector (Thermo Fisher Scientific Inc., Waltham, MA USA) and sequenced.

Phylogenetic analysis

Phylogenetic analysis was performed with polyproteins from selected members of the family Potyviridae. Sequences were aligned with Clustal W and the unrooted tree was built with RAxML-NG [21] using the maximum likelihood algorithm, a maximum of 1000 bootstrap replicates, and bootstopping (autoMRE, cutoff: 0.030000). Boostrapping converged after 150 replicates.

Mechanical inoculation of Nicotiana benthamiana Domin. and alfalfa (Medicago sativa L.) plants

Symptomatic leaves from field alfalfa plants were homogenized in cold 20 mM potassium phosphate buffer, pH 7.0, using a sterile mortar and pestle. The resulting suspension was briefly centrifuged to precipitate plant debris and ten microliters of the supernatant were rubbed onto carborundum-dusted leaves of three-weeks old N. benthamiana plants using sterile inoculating loops. Carborundum-dusted leaves of the three weeks-old seedlings of two alfalfa cultivars, cv. CUF 101 and cv. Maverick, were rub-inoculated with purified viral preparations using sterile inoculating loops.

Virus purification

The virus was partially purified from 20 g of symptomatic N. bentamiana leaves precisely as described in the protocol developed for Poinsettia mosaic virus [22]. Briefly, symptomatic N. benthamiana leaves were homogenized in 0.07 M phosphate buffer (pH 7.2) containing 0.I % mercapto-acetic acid. Plant debris was removed by squeezing through cotton cloth, and the sap was mixed with n-butanol to 8% (v/v). After 30 min at 18°C, the mixture was used for one cycle of differential centrifugation (20 min at 12 000 g; 90 min at 65 000 g) and the final pellet was resuspended in 0.03 M phosphate buffer [22].

Transmission electron microscopy

For transmission electron microscopy (TEM), copper TEM grids were incubated on the drop of purified viral preparation for 2 min, rinsed with one milliliter of sterile water and stained with 1% phosphotungstic acid (PTA) solution. The grids were examined in a Hitachi H-7700 Electron Microscope at the Electron and Confocal Microscope Unit, Beltsville Agricultural Research Center.