Vector construction

The expression vector encoding hACE2 was developed by inserting the hACE2 sequence into an EF1a promoter-driven expression construct. The pMD2.G envelope plasmids encoded VSVg glycoproteins under the regulation of the CMV promoter, and psPAX2 packaging plasmids encoded gag and pol genes (Addgene, Cambridge, MA, USA). The plasmid encoding the SARS-CoV-2 S protein for pseudovirus envelope expression was a gift from Professor Paul D. Bieniasz (The Rockefeller University, New York), and plasmids encoding the SARS-CoV-2 variant S protein, such as the Delta variant (B.1.617.2, plv-spike-v8) and Omicron variant (B.1.1.529/BA.1, plv-spike-v11) envelopes, were purchased from InvivoGen (San Diego, CA, USA). The pLenti-sffv-NanoLuc-PGK-RFP-T2A-PURO Lentiviral Reporter Plasmid was purchased from ALSTEM (Richmond, CA, USA). All reagent information was described in detail in the supplementary additional materials.

Cell culture

We cultured 293T, Huh7, VeroE6, and Caco-2 cells (KCLB, Seoul, Korea) in monolayers as described previously [8] in DMEM supplemented with 1% L-glutamine, 1% penicillin–streptomycin, 1% non-essential-amino acid (Cytiva, Marlborough, MA, USA), and 10% fetal bovine serum (FBS; Thermo Fisher Scientific, Gibco, Waltham, MA, USA). Raji (ATCC, CCL-86) and U937 cells (KCLB, 21593.1) were cultured in RPMI-1640 medium supplemented with 1% L-glutamine, 1% penicillin–streptomycin, 1% non-essential-amino acid (Cytiva), and 10% FBS (Thermo Fisher Scientific). ExpiCHO-S cells (Thermo Fisher Scientific) were maintained in the ExpiCHO™ Expression Medium. All cells were maintained in a humidified shaking incubator at 37 °C in a 5% CO2 atmosphere and sub-cultured twice a week at a density of 0.2 × 106 cells/mL.

Phage display for antibody screening

OPAL, the human synthetic single-chain fragment variable (scFv) library expressed with scFv and HA tags with 7.6 × 109 diversity, was provided by Ewha Womans University [9]. The antibody library was transformed into ER2738 Escherichia coli cells and incubated in 2 × YT medium containing 50 μg/mL carbenicillin and 2% glucose at 37 °C for 2 h. After 2 h, helper phages (multiplicity of infection (MOI) = 20) were treated and infected at 37 °C for 1 h, followed by centrifugation at 2900 × g, 30 °C for 20 min. The collected pellets were transferred to 2 × YT medium containing 50 µg/mL carbenicillin and 70 µg/mL kanamycin and incubated overnight at 30 °C. The phages were extracted using a polyethylene glycerol (PEG; Sigma-Aldrich, St. Louis, MO, USA)-based precipitation method. The phages displaying scFv were harvested for bio-panning to screen the SARS-CoV-2 Delta (B.1.617.2) variant RBD-binding scFv. Briefly, B.1.617.2 RBD was conjugated with epoxy magnetic beads (Invitrogen, Waltham, MA, USA), incubated with the phage library, and washed thrice with 0.1% PBS-T. Next, B.1.617.2 RBD-bound phages were eluted and transformed into freshly cultured ER2738 Escherichia coli cells. Bio-panning was performed by repeating five rounds, antibody candidates were selected through enzyme-linked immunosorbent assay (ELISA), and the complementarity-determining region (CDR) was confirmed by sequencing (Macrogen, Seoul, Korea).

Production of humanized IgG antibodies and of neutralizing antibodies

The scFv coding sequence with confirmed scFv-SARS-CoV-2 RBD (wild-type [WT], B.1.617.2, and B.1.1.529)-binding ability was amplified using forward and reverse primers containing restriction sites for insertion into a two-vector human IgG system (heavy and light chain human IgG vectors).

Briefly, each VH primer (FW: 5′-TCGCGCGCACTCCGAGGTGCAGCTGTTG-3′; RV: 5′-CACGTCTCTATGCTGAGCTCACGGTGAC-3′) was designed with BspE1 and Bsa1 restriction sites at the 5′- and 3′-ends, respectively, and VL primers (FW: 5′-AGCCTCTCCGGACAGTCTGTGCTGACT-3′, RV: 5′-CAGGTCTCGTTCGTAGGACCGTCAGCT-3′) possessed the BssH11 and BsmB1 restriction sites at the 5′- and 3′-ends, respectively. The amplified VH fragment was inserted into the cloning site of the TGEX-HC vector, and the VL domain was ligated into the cloning site of the TGEX-LC vector (Antibody Design Labs, San Diego, CA, USA). Escherichia coli DH5α-competent cells (RH618; RBC Bioscience, New Taipei, City, Taiwan) were used for plasmid amplification, and all clones were confirmed via restriction mapping and DNA sequencing (Macrogen). Heavy and light chain IgG plasmids were co-transfected into ExpiCHO-S cells according to the manufacturer’s instructions (A29127; Thermo Fisher Scientific, Waltham, MA, USA). We purified human IgG using protein A agarose resin (Amicogen, Jinju, Korea) and an affinity chromatography column (Bio-Rad Laboratories, Hercules, CA, USA).

ELISA analysis

ELISA analysis was performed as described previously [10]. The 96-well half area plates (Corning Life Sciences, Corning, NY, USA) were coated with WT, B1.617.2 and B.1.1.529 spike proteins (R&D systems, MN, USA) containing 1 × PBS (30 ng/ 30 μL per well) overnight at 4 °C, respectively. After washing three times with 0.05% PBS-T, the coated wells were blocked and incubated with anti-SARS-CoV-2 antibodies for 1 h at room temperature. After washing, 30 μL of 0.8 mg/mL HRP-conjugated anti-human antibody was added and the plate was incubated for 1 h room temperature. After three times washing, tetramethylbenzidine substrate was added at room temperature, and the reaction was stopped with 2N H2SO4. Absorbance was read at 450 nm on microplate reader (Promega, Madison, WI, USA).

Generation of stable hACE2 cell lines

To establish Huh7-hACE2-Puro cells, cells containing lenti-hACE2 transfer plasmids and psPAX2 packaging plasmids were co-transfected into HEK293T cells with the corresponding envelope plasmid (pMD2.G). HEK293T cells at 80% confluence in a T-75 flask were transfected with Opti-MEM with lipoplexes containing transfer plasmids (8 μg), envelope plasmids (8 μg), psPAX2 plasmids (8 μg), Plus Reagent (100 μL; Life Technologies, Carlsbad, CA, USA), and Lipofectamine 3000 (50 μL). After 24 h, the medium was replaced with DMEM supplemented with 10% FBS. Briefly, the virus-containing medium was harvested 72 h after transfection, centrifuged at 1500 × g for 10 min, and subsequently pre-cleaned using 0.45-μm filters (Merck Millipore, Burlington, MA, USA). Huh7 cells (1 × 104/plate) were transduced with 1 MOI hACE2/Puro vectors. After 24 h, the medium was replaced with fresh medium, and the plates were incubated for 72 h. The infected cells were supplemented with puromycin (final concentration: 10 μg/mL). The selection medium was replaced every 3 days for 2 weeks.

Packaging of SARS-CoV-2 variant pseudoviruses

SARS-CoV-2 wild-type (WT) and B.1.617.2 or B.1.1.529 variant pseudoviruses were produced as previously described [11]. To produce SARS-CoV-2 wild-type (WT) and B.1.617.2 or B.1.1.529 variant pseudoviruses, HEK293T cells were transfected when they reached 80% confluence in a T-75 flask. The transfection mixture consisted of pLenti-sffv-NanoLuc-PGK-RFP-T2A-PURO Lentiviral Reporter Plasmid (14 μg), envelope plasmids encoding SARS-CoV-2 S protein (8 μg), psPAX2 plasmids (8 μg), and Lipofectamine 3000 (75 μL) in Opti-MEM. After 24 h, the medium was replaced with DMEM supplemented with 10% FBS. The pseudovirus-containing medium was harvested 72 h after transfection, centrifuged at 500 × g for 10 min, and subsequently pre-cleaned using 0.45-μm filters (Merck Millipore, Burlington, MA, USA). The clarified supernatant was then mixed with 1/3 volume of Lenti-X Concentrator (Takara Bio, Japan) and incubated at 4 °C for 1 h. After incubation, the mixture was centrifuged at 1500 × g for 45 min at 4 °C, and an off-white pellet was resuspended with 1 mL of PBS. The resuspended pseudovirus was stored at − 70 °C until used.

SARS-CoV-2 variant pseudovirus neutralization assays

Huh7-hACE2 cells were infected with a lentivirus-based nano-luciferase expressing SARS-CoV-2 pseudovirus for neutralization antibody candidate screening. Luciferase activity was measured as a surrogate for pseudovirus neutralization levels. Thirteen neutralizing antibodies with cross-reactivity were first tested at a single concentration of 1 μg/mL for 72 h for binding to SARS-CoV-2 variants, namely WT, B1.617.2, and B.1.1.529. Furthermore, 1 × 104 cells (hACE2-Huh7) were plated on a white 96-well plate (Costar 3610; Corning Life Sciences, Corning, NY, USA), co-incubated with pseudovirus (1 MOI) and the serially diluted antibody (PBS or 1, 10, 100, 1, 10, or 100 μg/mL) for 1 h at 37 °C, and added to the wells. After 24 h, the medium was replaced with fresh medium, and the plate was incubated for 72 h. After 72 h, the cells were incubated for 3 h at 37 °C in the presence of EZ-CYTOX reagent (10% tetrazolium salt; Dogenbio, Seoul, Korea) for cytotoxicity assessment. Nano-luciferase activity was measured using a nano-luciferase reagent (Promega, Madison, WI, USA).

Surrogate neutralization assays

SARS-CoV-2 surrogate virus neutralization test kit was obtained from Genscript (NJ, USA) and the tests were carried out according to the manufacturer’s instructions. The Antibody (SKAI-DS10, 64, 84 and Bamlanivimab) was diluted 1:10 and mixed with an equal volume of HRP-conjugated to B.1.617.2 RBD or B.1.1.529 RBD (6 ng) and incubated for 30 min at 37 °C. A 100 μl volume of each mixture was added to each well on the microplate coated with ACE-2 receptor. The plate was sealed and incubated at room temperature for 15 min at 37 °C. After washing three times with wash solution, 100 μl tetramethylbenzidine substrate was added each well and incubated in the dark at room temperature for 15 min. The reaction was stopped by addition of 50 μl stop solution to each well and the absorbance was read at 450 nm on microplate reader (Promega, Madison, EI, USA).

Quantitative reverse transcription PCR (RT-qPCR) analysis

Vero E6 cells (1 × 105) were plated in a 6-well plate (Costar 3610; Corning Life Sciences, Corning, NY, USA). B.1.617.2 or B.1.1.529 was incubated with the SKAI-DS84 antibody at the indicated concentrations (tenfold serial dilution) for 1 h at 37 °C and then added to the wells of the 6-well plate seeded with Vero E6 cells.

Three days after incubation, total cellular RNA was extracted using an RNeasy® mini kit (Qiagen, Hilden, Germany) per the manufacturer’s instructions. The yield of the extracted RNA was assessed spectrophotometrically. The expression of B.1.617.2 or B.1.1.529 RNA and cellular RNAs was measured using RT-qPCR. The expression of each gene was normalized to that of the endogenous reference gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH). DNA quantification was performed using a QuantStudio3 real-time PCR detection system (Applied Biosystems, Waltham, MA, USA). The primers used for RT-qPCR were as follows: FW-SARS-CoV-2-B.1.617.2: CCACAAAAACAACAAAAGTTGG, RV-SARS-CoV-2-B.1.617.2: TGAGAGACATATTCAAAAGTGCAA, FW-SARS-CoV-2-B.1.1.529: GGACCCTCAGATTCAACTGG, RV-SARS-CoV-2-B.1.1.529: GCAGTATTATTGGGTAAACCTTGG, FW-GAPDH: TGGTCTCCTCTGACTTCA, and RV-GAPDH: CGTTGTCATACCAGGAAATG.

Tissues were weighed and homogenized with zirconia beads in a MagNA Lyser instrument (Bio-Rad Laboratories) in 10 mL of DMEM supplemented with 2% heat-inactivated FBS. Tissue homogenates were clarified by centrifugation at 10,000 × g for 5 min and stored at − 80 °C. RNA was extracted using a MagMax mirVana total RNA isolation kit and a Kingfisher duo prime extraction machine (Thermo Fisher Scientific). The SYBR Green RT-qPCR assay (one step) was performed according to the manufacturer’s instructions using a QuantiFast SYBR® Green RT-PCR kit (Qiagen); 8 μL of target RNA and 1 μL [10 pM/μL] of each primer (L Primer: CCCTGTGGGTTTTACACTTAA; R primer: ACGATTGTGCATCAGCTGA; probe: 5'-FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3) were added to 12.5 μL 2 × Master Mix QuantiFast SYBR Green RT-PCR, 0.25 μL of enzyme RT-Mix, and Ultra-Pure Water (Thermo Fisher Scientific) (final reaction volume: 25 μL). The reverse transcription reaction conditions were as follows: 50 °C for 10 min, 95 °C for 5 min, and 40 cycles of 95 °C for 10 s and 60 °C for 30 s. The reaction was completed by determining the dissociation curve of all amplicons generated using an ABI 7500 device (Applied Biosystems).

Animal experiments

Animal experiments were performed as described previously [12]. For animal experiments, 8-week-old male B6.Cg-Tg(K18-ACE2)2Prlmn/J mice (The Jackson Laboratory, CA, USA) were housed in a certified animal biosafety level 3 (ABSL3) facility at the Ji Seok-Yeong Biomedical Research Institute of Seoul National University Bundang Hospital in Seongnam, Republic of Korea. All procedures were approved by the Institutional Animal Care and Use Committee (Approval No. BA-2108-325-078), and the Institutional Biosafety Committee of Seoul National University Bundang Hospital approved biosafety experimental protocols (Approval No. IBC-2105-A-008). The hACE2-transgenic (TG) mice (five mice in each group) were intranasally inoculated with 50 μL of Omicron variant virus (1 × 105 PFU) under anesthesia. After four hours of infection, either PBS or 50 mg/kg of SKAI-D84 was intravenously injected. Lung, spleen and duodenum tissues were harvested from hACE2-TG mice two and seven days after SARS-CoV-2 Omicron variant infection, and viral RNA was quantified using RT-qPCR.

The B.1.1.529 strain (accession number: NCCP43408) was purchased from the Korea Centers for Disease Control and Prevention (KDCDC03/2020) and Vero E6 cells (CRL-1586) from the Korea Microbial Resource Center (KCTC). All experiments with SARS-CoV-2 were performed at the Biosafety Level 3 (BSL3) Laboratory of the Seoul National University Bundang Hospital.

Virus quantification (TCID50)

The tissue culture infectious dosage (TCID50) was determined utilizing the Reed–Muench technique. Vero E6 cells were allocated in 12-well plates at a density of 3 × 105 cells per well, and allowed to form a monolayer by the day before the plaque assay. The cells underwent a one-hour infection in duplicate with tenfold serial dilutions of B.1.512, and were then covered with a 0.3% SeaPlaque (LONZA, Basel, Switzerland) agarose medium inclusive of 2% FBS. Post a 72 h incubation period, the virus-infected cells were fixed with a 4% paraformaldehyde solution for an hour, followed by staining using a crystal violet solution (548-62-9, Sigma–Aldrich, St. Louis, USA). The viral titers were quantified in plaque-forming units (PFU) per milliliter.

Histopathology analysis

Lung and spleen tissues were fixed in 10% neutral buffered formalin for 1 day. Paraffin-embedded sections (3 µm) were stained with hematoxylin and eosin (H&E). The lesions were graded using a semi-quantitative scale based on the percentage of tissue affected by pathological changes as follows: 0: absent; 1: minimal, less than 10% of tissue affected; 2: mild, more than 10% but less than 25% of tissue affected; 3: moderate, more than 25% but less than 50% of tissue affected; 4: moderately severe, more than 50% but less than 75% of tissue affected; and 5: severe, more than 75% of tissue affected. Pulmonary lesions were evaluated based on the presence and abundance of the following symptoms: (1) pulmonary inflammation, involving the perivascular/peribronchial spaces with a moderate number of inflammatory cells surrounding the regions and interstitial spaces with more than five inflammatory cells in each alveolar space; (2) pulmonary edema, involving the perivascular spaces exhibiting edematous cuffs and alveolar edematous spaces. Splenic lesions were evaluated based on the scoring for apoptosis in the white pulp, which was determined based on the extent of the area affected. The scoring of white pulp atrophy was based on the extent of size reduction compared with that of the normal splenic white pulp. The histopathological scores were determined by two veterinary pathologists.

Antibody dependent enhancement assay

For antibody-dependent enhancement analysis, lentivirus-based SARS-CoV-2 pseudovirus expressing nano-luciferase was used to infect Huh7-hACE2, Raji, and U937 cells. Luciferase activity was measured as a surrogate for pseudovirus infection levels. SKAI-DS84 was tenfold serially diluted from 100 to 2 × 10–5 μg/ml and pre-incubated for 1 h with pseudovirus SARS-CoV-2 WT at 1 MOI. In parallel, 1 × 104 cells (hACE2-Huh7, Raji, and U937) were plated in white 96-well plates (Costar 3610; Corning Life Sciences, Corning, NY, USA), and the virus pre-mixed with SKAI-DS84 was added to the wells. After 24 h, the medium was replaced with fresh medium, and the plates were incubated for 72 h. Following 72 h, nano-luciferase activity was measured using the Nano-Glo Luciferase Assay System (Promega, Madison, WI, USA).

Surface plasmon response (SPR) assay

B.1.1.529.1 (BA1) or B.1.1.529.2 (BA2) proteins (3 µg/mL) in 10 mM sodium acetate (pH 4.5) were covalently immobilized on a CM5 chip (Cytiva, Marlborough, MA, USA). Immobilization of the captured protein was achieved by standard amine coupling chemistry (Cytiva); the flow cells were activated with a 1:1 mixture of 0.4 M 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC) and 0.1 M N-hydroxysuccinimide (NHS) at a flow rate of 30 µL/min. Reference flow cells were used as blanks and activated as previously described [13]. BA1 and BA2 proteins were mixed with sodium acetate (pH 4.5) and target (100 RU), resulting in a surface density of approximately 240 RU. Both surfaces were blocked by injecting 1 M ethanolamine/HCl (pH 8.5). The SKAI-DS84 antibody was injected into both flow cells at 25, 12.5, 625, 3.13, 1.56, or 0.78 nM at a flow rate of 30 µL/min, contact time of 120 s, and dissociation time of 600 s. A regeneration solution comprising 10 mM glycine (pH 2.1) was injected for 30 s at a flow rate of 30 µL/min. The values obtained for reference flow cells were subtracted from the analyte binding responses, and the final data for both flow cells were analyzed using BIA evaluation 2.0 software (Biacore; Cytiva) in a 1:1 binding of globally fitting data to derive kinetic and equilibrium parameters.

Protein thermal shift (PTS) analysis

PTS analysis was performed according to the manufacturer’s instructions (Invitrogen, Waltham, MA, USA), following the binding of three SKAI-DS (10, 63, and 84) antibodies to each of the B.1.617.2 and B.1.1.529 variant RBD antigens. All individual experimental data were analyzed using the recommended Protein Thermal Shift™ Software v1.4 (Thermo Fisher Scientific).