Materials

Polyamidoamine (PAMAM (G5), Mw: 28,826) was provided by Weihai Chenyuan Molecular New Materials Co., Ltd. (China), amino and hydroxyl groups protected bone-targeting peptides were procured from Jill Biochemical (Shanghai) Co., Ltd. Polyethylenimine hydrochloride (PEI, linear, average Mn 20,000, PDI ≤ 1.2) was obtained from Sigma-Aldrich (USA). Lipofectamine™ 2000 (Lipo™ 2000) was purchased from Thermo Fisher Scientific (USA). 4-amino-1,8-naphthalic anhydride was obtained from Ruixibio (Xi’an, China). 1-hydroxybenzotriazole (HOBt), dimethyl sulfoxide (DMSO), and 1-ethyl-3-(3-dimethylaminopropyl) carbonyldiimide hydrochloride (EDCl) were purchased from Beijing Ouhe Technology Co. Ltd. (Beijing, China). Diisopropylethylamine (DIPEA), triethylamine, p-methylphenol, pentobarbital sodium, and 3-(4, 5-dimethylthiazolyl-2)-2, 5-diphenyltetrazolium bromide (MTT) was purchased from Beijing Solarbio Science & Technology Co., Ltd. (Beijing, China), trifluoroacetic acid (TFA) was obtained from Beijing Coupling Technology Co., Ltd. MiR 138-5p (antagomir (5'CGGCCUGAUUCACAACACCAGCU3') and NC (F-5'AGCUGGUGUUGUGAAUCAGGCCG3' R-5'UCGACCACAACACUUAGUCCGGC3') were obtained from GenePharma (Shanghai, China), and EGFP siRNAs (F-5’GGCUACGUCCAGGAGCGCACC3′ R-5’UGCGCUCCUGGACGUAGCCUU3′) were obtained from GenePharma (China). Primers were synthesized and obtained from TsingKe (Beijing, China). RNA in this article refers to the antagomir 138-5p unless specified. As a solvent for chemical preparation, milli-Q grade distilled and deionized water was used in all experiments.

Synthesis

Dendritic molecule polyamidoamine G5 (1.0 equivalents (eq)) and 4-amino-1,8-naphthalic anhydride (10 eq) were dissolved in 1 ml of ethanol solution, stirred for 0.5 h at room temperature, heated for 8 h, and dialyzed for 48 h to obtain compound 1. In this article, we referred to this compound 1 as P. Naphimide-modified compound 1 (1.0 eq) was dissolved in the mixture of EDCI (80 eq), HOBt (80 eq), and DIPEA (80 eq) with 80 equivalents of amino and hydroxyl-protected bone-targeted peptides in 2 ml of dichloromethane for 24 h. After the end of the reaction, the mixture was dialyzed for 48 h to obtain compound 2. Compound 2 was dissolved in 2 ml of TFA at room temperature for 24 h and dialyzed for 48 h to obtain the final compound (compound 3) (Fig. 1A). In this article, we referred to this compound 3 as PS (PAMAM-SDSSD).

Fig. 1

Design and Synthesis of PS. A Chemical synthesis route of PS. B Schematic diagram of PS showcasing the design of the nucleic acid delivery system

CharacterizationScanning electron microscopy (SEM)

The morphology of particles was determined by scanning electron microscopy according to a previously established protocol [38]. Briefly, 1 μl of antagomir 138-5p (200 μg/mL) was mixed with the appropriate volume of PS nanoparticle solution to form complexes and then diluted with water. After incubation at 37 °C for 5 min, complexes were added dropwise onto the silicon slice. The slice was dried at room temperature at atmospheric pressure overnight and then observed under a scanning electron microscope.

1H NMR

The structural composition of compounds was investigated according to the previous protocol [39] through 1H NMR spectra analysis using a Bruker Avance III 400 MHz spectrometer at 25 °C using D2O as a solvent.

Zeta potential and size

The complex of PS with RNA was prepared by adding 1 μl of antagomir 138-5p (264 μg/ml) to the appropriate volume of the stock solutions of PS. After 30 s of vortexing, the complex solution was diluted with deionized water. The zeta potential and the hydrodynamic size were measured using the Nano-ZS 3600 ZetaPlus Particle Size and Zeta Potential Analyzer (Malvern Panalytical, Worcestershire, UK).

Gel retardation assay

The different molecular weight ratio complexes of PS with RNA were prepared by adding the appropriate volume of the polymers to 80 nM of antagomir-138-5p. After incubation for 20 min at room temperature, the samples were analyzed using 1% (w/v) agarose gel electrophoresis with Tris–acetate (TAE) as a running buffer for 30 min at 120 V. The bands were visualized using the Gel Doc XR imaging system (BioRad, USA) and processed using Quantity One software.

Cell culture and transfection

The mouse pre-osteoblasts (MC3T3-E1 cells) were cultured in α-Minimal Essential Media (MEM), and mouse leukemic monocyte/macrophage (RAW264.7) (ATCC (Manassas, USA), HEK293-EGFP transgenic cells, and C3H10T1/2 were cultured in Dulbecco’s Modified Eagle Medium (DMEM, Gibco™, Thermo Fisher Scientific) media, respectively, supplemented with 10% FBS (Biological Industries, Israel), 100 µg/ml streptomycin, and 100 units/ml penicillin (Amresco, USA) and maintained at 37 °C, 5% CO2, and 95% humidity. 0.25% trypsin containing 10 mM EDTA was used for the passage of cells in the experiment.

For cell transfection, MC3T3-E1 or RAW264.7 were seeded at a cell density of 8 × 104 cells cm−2 and transfected with antagomir-138-5p or agomir-138-5p (negative control (NC)) only, and with PS and P. The antagomir or NC concentration was 50 nM. After incubation for 6 h, the serum-free medium was replaced by a fresh growth medium containing 10% FBS. 48 h after transfection, cells were harvested for real-time polymerase chain reaction (PCR) or cytotoxicity assays.

Cytotoxicity

The cell viability assay was performed to assess the cytotoxic effect of PEI or PS on MC3T3-E1, RAW 264.7, and C3H10T1/2. Briefly, MC3T3-E1, RAW264.7, and C3H10T1/2 were seeded in the appropriate medium and exposed to various concentrations of PEI, or PS. After treatment for 12 h, the spent medium was replaced with MTT solution (5 mg/ml in PBS), and the plates were further incubated for 4 h in the incubator. After incubation, DMSO was added to each well, and absorbance was measured at 570 nm using a microplate reader (Synergy HT, Bio-Tek, USA).

EGFP gene knockdown experiment

HEK293-EGFP cells were seeded in a 48-well plate at a density of 8 × 104 cells per well in 0.5 ml culture medium and incubated overnight. After reaching 80%-90% confluence, cells were transfected with green fluorescent protein (GFP) siRNA using P, PS, Lipofectamine™ 2000, or PEI polymers for 6 h in serum-free media (siRNA at a final concentration of 120 nM/well). The transfection medium was replaced with a culture medium and cells were incubated for another 24 h. The EGFP expression was measured using fluorescence microscopy. ImageJ software was used to semi-quantify images. P, Lipofectamine™ 2000, and PEI-treated groups served as positive controls.

RNA extraction and real‐time quantitative PCR (RT-qPCR)

Total RNA was extracted from cell samples using the Omega Total RNA Kit (Omega, USA) according to the manufacturer's instructions, and RNA quality was determined by ultraviolet (UV) spectrophotometry. 1 μg of total RNA was reverse transcribed into complementary DNA using a cDNA synthesis kit (PrimeScript™ RT Reagent Kit, TaKaRa, Japan) following the manufacturer's instructions. The primer sequence for miR 138-5p reverse transcription was 5’-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCGGCCT-3’. Real-time quantitative PCR was performed using the SYBR® Premix Ex Taq™ II kit (TaKaRa, Japan) and gene-specific primers (MACF1 F‐5′‐GAAAACATTCACCAAGTGGGTCAAC‐3′, R‐5′‐TGTCCATCCCGAAGGTCTTCATAG‐3’; GAPDH F‐5′‐TGCACCACCAACTGCTTAG‐3′, R‐5′‐GGATGCAGGGATGATGTTC‐3’; miR-138-5p F-5’- GCGGCGGAGCTGGTGTTGTGAATC-3’, R-5’- ATCCAGTGCAGGGTCCGAGG-3’; U6 F-5’-GTGCTCGCTTCGGCAG CACATAT-3’, R- 5’-RAAAATATGGAACGCTTCACGAA-3’), using the CFX96 Touch Thermal Cycler (Bio-Rad, USA) with an initial denaturation at 95 °C for 30 s, followed by 45 cycles of denaturation, primer annealing, and primer extension at 95 °C for 10 s, 60 °C for 30 s, and 72 °C for 5 s, respectively. PCR data were analyzed with the comparative CT method (2−ΔΔ CT). Gapdh and U6 served as internal controls for the mRNA and miRNA analyses, respectively.

Mice and mouse modelsMice

6-week-old C57BL/6 J female mice weighing 19.8 g were purchased from the Laboratory Animal Center of Air Force Medical University, Xi'an, Shaanxi, China, and were maintained in specific-pathogen-free (SPF) conditions with free access to water and feed. All animal experiments were performed in compliance with relevant ethical regulations of the Guiding Principles for the Care and Use of Laboratory Animals (the Institutional Experimental Animal Committee of Northwestern Polytechnical University, Xi’an, China [202000001]) and were approved by the Institutional Experimental Animal Committee of Northwestern Polytechnical University, Xi’an, China.

Osteoporosis OVX mouse model

The OVX mouse model was constructed using 8-week-old female C57BL/6 J mice according to a previously established procedure [40]. Briefly, a single midline dorsal incision was made on the back of anesthetized mice, and subcutaneous connective tissue was freed from the underlying muscle on each side. The ovaries were located under the thin muscles, and by securing a single ligature around the oviduct, the ovaries were removed. The muscle layers and skin incision were sutured. Mice were then kept under observation for a full recovery and then randomly divided into different groups.

Pre-therapeutic evaluation of anti-miR-138-5p delivered by PS to OVX mice

Nine 8-week-old female C57BL/6 J mice were ovariectomized (OVX) and then left untreated for 4 weeks. OVX mice were then divided into three groups: the OVX group, the PS + NC group, and the PS + RNA group. The OVX group received PBS; the PS + NC and PS + RNA groups received 100 μl of PS + NC and PS + antagomir 138-5p, respectively, with an NC or antagomir dose of 1 mg/kg. The mice in each group received four periodic intravenous (tail vein) injections at an interval of 1 week for 4 weeks. Table 1 summarized the experimental groups and dosage administered during the treatment period. After completion of treatment, mice were euthanized, and bones were collected for further analysis (Fig. 6A).

Table 1 Experimental groups and dosage during treatmentDual-energy X-ray absorptiometry (DXA)

The mice were sedated with pentobarbital sodium (1.2 mg/10 g) and placed on the specimen tray of the DXA body composition analysis system (InAlyzer, Medikors) in a prone position for scanning. Radiographic images as well as related parameters of various bone regions were acquired using InAlyzer Dual X-ray Digital Imaging Software (InAlyzer, Medikors).

Mechanical properties of bone

The mechanical properties of the femur were investigated using a three-point bending test, as previously described [41]. A UniVert (CellScale Biomaterials Testing, Canada) was used to perform a three-point bending test on each femur. The femurs were placed horizontally on two supports spaced 5 mm apart. To load the midpoint of the femur, an accutator was lowered at a speed of 1.0 mm per minute. The bending load was applied continuously until the fracture occurred. Load and displacement data were collected at a 100 Hz sampling rate.

Statistical analyses

The mean ± SD is used to express all statistical data. Unpaired student's t-tests were used to analyze the significant differences between the two groups. Two-way ANOVA was performed to compare the differences among multiple groups followed by Tukey’s test.All statistical analyses were performed using GraphPad Prism 7 software. P < 0.05 was regarded as statistically significant. For the experiment, significance was defined as *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001.