Human trophoblast cells HTR-8/SVneo were purchased from the American Type Culture Collection (ATCC, USA). Cells were cultured in RPMI 1640 medium (Procell, Wuhan, China) containing 10% fetal bovine serum (FBS; Gibco, MD), 1% penicillin and streptomycin. Cells were incubated at 37 °C and 5% CO2 and routinely passaged every 3 days.

pcDNA3.1-NC (empty vector), pcDNA3.1-BMP9, si-NC (empty vector), si-BMP9 and si-SDF1 were purchased from GeneChem (Shanghai, China). Cells were transfected with plasmids using Lipofectamine 2000 (Invitrogen, Carlsbad, USA). After 24 h of transfection, the cells were tested for transfection efficiency and subsequent experiments were performed.

This study selected pregnant women who underwent antenatal care and delivery in the obstetrics department of Weapon Industry 521 Hospital from January 2020 to December 2021, including 20 PE patients and 20 healthy pregnant women. All patients were primigravida with a gestational age of 34–39 weeks. In addition to PE, patients with PE had no other medical and surgical complications. Healthy pregnant women selected as controls had gestational age and body mass index similar to PE patients. Pregnant blood was collected for centrifugation, and plasma was retained for subsequent studies. All subjects signed informed consent. The study was approved by the Weapon Industry 521 Hospital Ethics Committee.

Plasma levels of BMP9, SDF1 and CXCR4 were determined using ELISA kits. The kit details are as follows: Human BMP9 ELISA Kit (ab267648, abcam, UK), Human CXCL12/SDF-1 ELISA Kit (PC205, Beyotime, China), Human CXCR4 ELISA Kit (TW14529, Tongwei Industry, China). All operating steps in the experiment were carried out in accordance with the reagent manufacturer’s instructions.

In this experiment, Cell Counting Kit-8 (C0038, Beyotime, China) was used to detect the viability of HTR-8/Svneo cells. HTR-8/Svneo (1 × 104) cells were seeded in 96-well with culture plates, and CCK-8 assays were performed at 0, 12 h, 24 h, 48 h after seeding. Add 20 µl of CCK-8 solution to each well and incubate for 2 h. Use a microplate reader to measure the absorbance of each well at 450 nm.

Select cells (1 × 106) at 90% growth density and use a 200 µL micropipette to scrape the cells to make an even scratch. The damaged cells were washed with PBS and cultured in the incubator for 24 h. Cells were observed for wound healing at 0 and 24 h using a microscope.

First, Transwell chambers (Corning, USA) were coated with Matrigel (BD Biosciences, Germany). Approximately 1 × 105 transfected HTR- 8/Svneo cells in 200 µl serum- free medium were seeded into the top compartment of transwell chambers with- out or with Matrigel. After 24 h of incubation, cells in the lower chamber were fixed with 4% paraformaldehyde and stained with crystal violet (C0121, Beyotime, China) for 15 min. Cell invasion was observed and recorded under a microscope.

In this experiment, Annexin V-FITC/PI apoptosis detection kit (40302ES20, Qcbio, China) was used to determine the apoptosis level of cells. After cells were trypsinized without EDTA, they were centrifuged and collected. After the cell pellet was washed twice with PBS, the cells were resuspended in 100 µL of 1×Binding Buffer. Add 5 µl Annexin V-FITC and 10 µl PI to each 5 × 105 cells, and react at room temperature for 15 min. Add 400 µL of 1×Binding Buffer to the cells again to prepare the test sample. The rate of apoptosis was assessed using a FACS flow cytometry system (BD FACS Canto II USA).

Total RNA was extracted from HTR-8/SVneo cells using TRIzol reagent (Invitrogen). Next, RNA was reverse transcribed into cDNA using a reverse transcription kit (RR047A, Takara Bio Inc, Otsu). Quantitative PCR was performed using the DNA Engine Opticon™ Real-Time PCR System (MJ Research, MA). Gene expression levels were quantified using the 2−ΔΔCT method. The primer sequences were as follows: BMP9: Forward: 5’- CCTGGGCACAACAAGGAC − 3’; Reverse: 5’- CCTTCCCTGGCAGTTGAG − 3’.

SDF1: Forward: 5′-FCTCCGCTGTCACCTTCCC-3′;

Reverse: 5’-RTGTGCCCTTCAGATTGTAGCC-3’.

CXCR4: Forward: 5’- CCG AGG CCC TAG CTT TCT TC -3’;

Reverse: 5’-GAG GAT CTT GAG GCT GGA CC-3’.

GAPDH: Forward: 5’- CGCTCTCTGCTCCTCCTGTTC − 3’,

Reverse: 5’-ATCCGTTGACTCCGACCTTCAC-3’.

In this experiment, lysis buffer (P0013J, Beyotime, China) was used to extract the protein in the cells, and the concentration of the extracted protein was quantified. Protein samples were separated using 10% SDS-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride (PVDF) membranes. Membranes were blocked with 5% nonfat milk. Membranes were incubated overnight at 4 °C with diluted primary antibodies. Then, the membrane was incubated with the diluted secondary antibody for 2 h at room temperature. Protein expression levels were detected using Enlight TM-PLUS kit (17,100, Engreen Biosystem, China).

Data are presented as the mean of three independent biological replicates. Data were processed by GraphPad software, and differences between 2 groups were explored using unpaired t-test, and differences between more than two groups were analyzed by one-way ANOVA combined with Tukey’s test. P < 0.05 was considered statistically significant.