Cell culture

THP-1 human monocytic cell line was obtained from the American Type Culture Collection (ATCC Cat. #: TIB-202) and was cultured in RPMI 1640 GlutaMAX (Gibco Cat. #: 61870010) supplemented with 10% FBS (ThermoFisher Scientific Cat. #: 10270106) and 1% Penicillin-Streptomycin (ThermoFisher Scientific Cat. #: 15140122). MDA-MB-231 human breast cancer cell line (ATCC Cat. #: CCL-185) was cultured in DMEM F-12 K (Gibco Cat. #: 31331028) supplemented with 10% FBS (ThermoFisher Scientific Cat. #: 10270106) and 1% Penicillin-Streptomycin (ThermoFisher Scientific Cat. #: 15140122). MDA-MB-231 cells were transduced with a lentivirus expressing luciferase-GFP and sorted to generate MDA-MB-231-GFP cells, that were cultured as above. Human Umbilical Vein Endothelial Cells (HUVEC Promocell Cat. #: C-12203) were cultured in Endothelial Cell Growth Medium (ECM, Promocell Cat. #: C-22010) containing 10% FBS and grown in 1% pig gelatin (Sigma Cat. #: G9391)-coated plates. All cells were maintained at 37 °C in a 5% CO2 atmosphere.

Macrophage differentiation and polarization

1.5 × 106 cells THP-1 cells were differentiated with 20 ng/ml of phorbol 12-myristate 13-acetate (PMA, Sigma Cat. #: 524400) for 24 h in 6-well plates. After 24 h, the medium was changed. The following day, differentiated THP-1 macrophages were polarized adding recombinant human IFNγ (100 ng/mL, Biolegend Cat. #: 570206), IL-4 (20 ng/ml, Miltenyi Biotec S.L Cat. #: 130-112-411), or IL-13 (20 ng/ml, Miltenyi Biotec S.L Cat. #: 130-094-117) for a further 24, 48–72 h.

Knockout of SDC3 by CRISPR/Cas9

Deletion of SDC3 in THP-1 cells was performed using the following TrueGuide Synthetic gRNAs (sgRNAs) from ThermoFisher Scientific: CRISPR923443_SGM TrueGuide Synthetic sgRNA SDC3 (target DNA sequence: AACTGGATGACCTCTACTCG Cat. #: A35511) targeting the exon 2 of human SDC3 gene. Ribonucleoprotein (RNP) complexes were generated with 30 pmol of TrueCut Cas9 protein v2 (Invitrogen Cat. #: A36496) and 30 pmol of sgRNA. RNP complexes were introduced into cells using the Neon transfection system (Invitrogen Cat. #: MPK 1025) following the manufacturer’s instructions. 72 h after transfection, single-cell dilutions were performed in 96-well plates by sorting of transduced cells with a BD FACSAria Fusion sorter (BD Biosciences) (purity > 95%). Cells were grown and the absence of SDC3 was confirmed in each clone by Western blot.

Overexpression of SDC3

For SDC3 overexpression, the codon-optimized sequence of human full-length SDC3-3xFlag was synthetized and subcloned into a puromycin lentiviral vector: pLV-MSCV (Genscript). For the generation of lentiviral particles, 50–70% confluent HEK293T cells were transfected with JetPEI kit (Polyplus transfection #101–10 N) using a mix of lentiviral plasmids: 4 ug of psPAX2 (Addgene plasmid Cat. #: 12260), 1.5 ug of VSV-G (Addgene plasmid Cat. #: 8454) and 5 ug of SDC3 of the plasmid. After 48 h, lentiviral particles were harvested from the supernatant, filtered through a 0.45 μm filter and transduced into SDC3 KO THP-1 cells. SDC3 KO OE THP-1 cells were selected with 1.0 µg puromycin.

Isolation and culture of CD8+ T cells

With the approval of the Ethical and Scientific Committees (code CEIC E19-75), human peripheral blood mononuclear cells (PBMCs) were isolated from buffy coats provided by the Basque Biobank by Ficoll-Paque Plus (Cytiva Cat. #: 17144003) density centrifugation (1200 g for 10 min at RT) using SepMat-50 tubes (StemCell Cat. #: 85450). CD8+ T cells were magnetically isolated using the EasySep Human CD8+ T Cell Isolation Kit (StemCell Cat. #: 17953RF) and a RoboSep cell separator (StemCell) according to the manufacturer’s indications. Human CD8+ T cells were grown in OpTmizer™ CTS medium (ThermoFisher Scientific Cat. #: A1048501) supplemented with CTS Immune Cell Serum Replacement (ThermoFisher Scientific Cat. #: A2596101) and hIL2 (100 IU/ml, Miltenyi Biotec Cat. #: 097–743). For macrophage-T cell co-cultures, on the day of the experiment, 300.000 CD8+ T cells were added to 500.000 previously differentiated THP-1 macrophages in media containing 5 µg/ml of anti-CD3 (BD Biosciences Cat. #: 567118). CD8+ T cells were collected after 4 days and analysed by flow cytometry. For some of the conditions, CD8+ T cells were first pelleted and mixed with 5 µM of CFSE reagent (ThermoFisher Scientific Cat. #: C34554) for 7 min at 37 °C in the dark, followed by two washes, before incubation for 4 days.

Flow cytometry

Cells were blocked with a TruStain FcX blocker (Biolegend Cat. #: 101320) for 10 min at RT, followed by an incubation in the presence of fluorochrome-conjugated antibodies (listed in Supplementary Table 1) in flow cytometry staining buffer (Invitrogen Cat. #: 00-4222-26) for 30 min at 4°C in the dark. DAPI (ThermoFisher Scientific Cat. #: D1306) was used as a viability dye. Cells were acquired in a BD FACS Symphony A3 flow cytometer.

Cytokine quantification and ELISAs

Quantification of cytokines was performed with the LEGENDplex™ HU Essential Immune Response Panel. Briefly, beads pre-coated with antibodies for IL-4, IL-2, CXCL10 (IP-10), IL-1β, TNF-α, CCL2 (MCP-1), IL-17 A, IL-6, IL-10, IFNγ, IL-12p70, CXCL8 (IL-8) and Free Active TGF-β1, were incubated with cell supernatants. Once the analyte was bound, a cocktail of biotinylated antibodies was added, followed by PE-Streptavidin, which served to quantify cytokine concentrations alongside a standard curve by flow cytometry. Quantification of angiogenic factors was performed with the LEGENDplex™ Human Angiogenesis Panel 1. Briefly, beads pre-coated with antibodies for IL-6, Angiopoietin-1, Angiopoietin-2, EGF, FGF-basic, CXCL8 (IL-8), PECAM-1, PlGF, VEGF, TNF-α were incubated with cell supernatants. Once the analyte was bound, a cocktail of biotinylated antibodies was added, followed by PE-Streptavidin, which served to quantify cytokine concentrations alongside a standard curve by flow cytometry. Levels of VEGFA on cell supernatants were analysed using the Human VEGF ELISA Kit (R&D Systems Cat. #: DVE00), as per manufacturer´s instructions. Levels of TNF on cell supernatants were analysed using the Human TNF-alpha DuoSet ELISA (R&D Systems Cat. #: DY210), as per manufacturer´s instructions.

Western blot

Total cells were collected using 2 mM EDTA for 10 min, centrifuged and lysed with RIPA buffer (ThermoFisher Scientific Cat. #: 89900). Protein quantification was performed using the Pierce BCA Protein Assay Kit (ThermoFisher Scientific Cat. #: 23227). The procedure was followed as previously described [19]. Band intensities were determined by densitometric analysis using FIJI software.

Immunofluorescence (IF)

THP-1 cells were polarized on coverslips as described above and fixed in ice-cold methanol for 10 min. Next, permeabilization was performed using 0.1% triton X-100 for 5 min at RT, followed by blocking with 3% BSA for 15 min at RT. SDC3 primary antibody (R&D Systems Cat. #: AF3539), was incubated overnight at 4 °C in blocking buffer. The next day, coverslips were incubated with secondary anti-goat 555 antibody and DAPI for 2 h at RT, followed by washing and mounting with a ProLong gold antifade reagent. In some experiments, Phalloidin (Sigma Cat. #: P1951) was included with the secondary antibodies.

RT-qPCR

Total mRNA was extracted using the NucleoSpin RNA kit (Macherey-Nagel Cat. #: 740955.250), following manufacturer´s instructions. cDNA was synthesized using 1 µg of purified mRNA with M-MLV reverse transcriptase (ThermoFisher Scientific Cat. #: 28025-013) and random primers (ThermoFisher Scientific Cat. #: 58875) following manufacturer’s instructions. RT-qPCR was performed in a Real-Time PCR System (ThermoFisher Scientific) using PerfeCTa SYBR Green SuperMix reagent (Quantabio Cat. #: 95056-500) and gene-specific primers (Supplementary Table 2). Data was analyzed using QuantStudio version 1.3 (ThermoFisher Scientific), as described in previous work [19].

RNA sequencing and analysis (RNAseq)

Total mRNA was extracted using the NucleoSpin RNA kit (Macherey-Nagel Cat. #: 740955.250). RNA sample quantity and quality were evaluated using Qubit RNA HS Assay Kit (ThermoFisher Scientific Cat. #: Q32855) and Agilent RNA 6000 Nano Chips (Agilent Technologies Cat. #: 5067 − 1511), respectively. A total of 1 ug of mRNA was isolated, fragmented and primed. The first cDNA strand was synthesized with SuperScript-II Reverse Transcriptase (ThermoFisher Scientific Cat. #: 18064-014) and libraries were prepared using TruSeq Stranded mRNA library Prep kit (Illumina Inc. Cat. #: 20020594) and TruSeq RNA CD Index Plate (96 Indexes, 96 samples, Illumina Inc. Cat. #: 20019792), following the TruSeq Stranded mRNA Sample Preparation Guide (Part #15031058 Rev. E). The final dsDNA libraries were quantified by Qubit dsDNA HS DNA Kit (ThermoFisher Scientific Cat. #: Q32854) and qualified by an Agilent 2100 Bioanalyzer using Agilent High Sensitivity DNA kit (Agilent Technologies Cat. #: 5067 − 4626). Illumina 100 nucleotides paired-end sequencing was performed in a NovaSeq6000 (Illumina Inc.).

For the RNAseq analysis, sequencing data were converted into raw data (FASTQ files) using the Illumina bcl2fastq Conversion Software. QC and metric calculation of all fastq files were done with fastQC version v0.11.6. Compilation for inspection of all fastQC reports was done using multiQC version 1.13. Adapter trimming was performed using fastp version 0.23.2. Alignments of the reads into the reference genome hg38.bwa was performed using STAR version 2.7.10b. PCR Duplicates were removed from aligned BAM files with picard version 2.27.5 using the MarkDuplicates command. Additional statistics and information on the processed BAM files for inspection were obtained using samtools version 1.16.1 using the flagstat command and picard version 2.27.5. Indexing aligned BAM files was done using samtools version 1.16.1. Reads for analysed features were assigned and counted from the processed BAM files using SubRead’s FeatureCounts version v2.0.3. Differential gene expression analysis was performed by the DESeq2 version 1.40.2 [REF]. GSEA was performed in R using fgsea [20] and MSigDBR [21] packages. Hallmark and C2 to C7 gene collections were used. Volcano plots were generated using the ggplot2 package. The data is available and has been uploaded into the GEO repository (GEO accession GSE273450).

Phagocytosis assays

For the S. aureus particle phagocytosis assay, ThermoFisher Scientific Nunclon Sphere (ThermoFisher Scientific Cat. #: 174929) U-shape 96-well plate was used. 100 µl containing 200.000 WT or SDC3 KO THP-1 cells were incubated in each well with 100 µl of pHrodo™ Green S. aureus bioparticles (ThermoFisher Scientific Cat. #: P35367) for 1 h at 37 °C. pHrodo bioparticles are non-fluorescent outside the cell at neutral pH but fluoresce brightly in acidic pH environments, such as those of endosomes and lysosomes. To inhibit phagocytosis, cells were pre-treated with 10 µM Cytochalasin D (ThermoFisher Scientific Cat. #: PHZ1063). After 1 h, cells were collected for flow cytometry analysis and green fluorescence within THP-1 cells was calculated, normalized to the WT condition. Part of the sample was collected, stained with DAPI and Phalloidin, and cytospined onto slides. Slides were then fixed with ProLong gold antifade reagent (ThermoFisher Scientific, Cat. #: P3693), before acquisition with a Leica SP8 Lightning confocal microscope. For the cancer cell phagocytosis assay, 30.000 MDA-MB-231-GFP cells and 100.000 THP-1 WT or SDC3 KO cells were co-cultured in a U-shaped 96-well ThermoFisher Scientific Nunclon Sphere plate (ThermoFisher Scientific Cat. #: 174929). The mixture was incubated at 37 °C overnight. The next day, the cells were collected for flow cytometry analysis and GFP within THP-1 cells was used to calculate phagocytosis rate, normalised to the MDA-MB-231-GFP cells. Part of the sample was collected, stained with DAPI and cytospined onto slides. Slides were then fixed with ProLong gold antifade reagent (ThermoFisher Scientific, Cat. #: P3693), before acquisition with a Leica SP8 Lightning confocal microscope.

Breast cancer cell spheroid formation and proliferation assays

2.000 MDA-MB-231-GFP and THP-1 WT or SDC3 KO cells were co-cultured in a 96-well U-shaped plate (ThermoFisher Scientific Cat. #: 174929) and incubated at 37 °C to let spheroids naturally form. Pictures were taken every day in a Nikon Eclipse TS100 microscope. After 7 days of incubation, spheroids were collected for proliferation analysis by flow cytometry using counting beads (Invitrogen Cat. #: C36950).

Cell adhesion assay

THP-1 cells (150.000 cells/well) were cultured using a 48-well plate (Corning Cat #: 3548) in medium without FBS containing 2mM CaCl2, 2mM MgCl2 and 20 ng/ml of PMA for 1 h at 37 °C, followed by washing and staining with 0.2% crystal violet (Sigma Cat #: C6158). Stained cells were further lysed with 10% acetic acid and the optical density (OD) was measured at 595 nm in a PerkinElmer Victor Nivo multi-plate reader.

Cell proliferation

1 × 106 THP-1 WT, SDC3 KO and SDC3 KO OE cells were cultured in 7 ml of culture medium. Cell numbers were counted daily using an automated cell counter Countess 3 instrument (ThermoFisher Scientific product number: AMQAX2000).

Proteome profiler array

Differentiated WT and SDC3 KO THP-1 macrophages were polarized with 100 ng/ml of IFNγ for 2 h. Cells were collected with TrypLE (Gibco Cat. #: 2785288) and washed twice with PBS. For phospho-kinase identification, the Proteome Profiler Human Phospho-Kinase Array Kit was used (R&D Systems Cat. #: ARY003C) following the manufacturer’s instructions.

Tube formation assay

96-well plates (Corning Cat. #: 3595) were pre-coated with 50 µl of Matrigel (Corning Cat. #: 356231) for 1 h at 37 °C. HUVECs were dissociated with Trypsin-EDTA (0,25%) (ThermoFisher Scientific Cat. #: 25200056) and 30.000 cells were resuspended in 150 µl of THP-1 WT/KO-conditioned medium for 24 h at 37 °C. Tube formation was photographed under an Olympus IX-83 inverted microscope and analysed with FIJI software.

Cell migration assay

Cell migration was analysed using the xCELLigence Cell Invasion & Migration platform (Agilent). Briefly, THP-1 WT/KO conditioned medium was added to the lower chamber of Xcelligence 16-well CIM-Plates (Agilent Cat#: 5665825001). On the top chamber, 20.000 HUVECs were seeded, and migration was measured in real-time using the xCELLigence platform (Agilent), according to manufacturer´s instructions.

Statistics

Statistical analyses were performed using GraphPad PRISM 8 software (GraphPad). Plots show mean ± standard error of the mean (SEM). Comparisons between two groups were carried out using the paired Student’s t test. One-way ANOVA or two-way ANOVA with Tukey’s or Bonferroni′s post hoc test were performed for multiple group comparisons. Significant p values are indicated in Figure legends.