Human islets and cell lines

Human islets were isolated from pancreases of cadaveric donors through the Eurotransplant multiorgan donation programme. Islets were used for research only if they could not be used for clinical purposes, and if research consent was present, according to Dutch National Laws. Human islets with a purity >80% were cultured in ultra-low attachment plates (Corning ref. 3471, USA) with CMRL 1066 (Corning, 99-663-CV, 5 mmol/l glucose), supplemented with 10% FCS, 2 mmol/l l-glutamine, 100 U/ml penicillin, 100 µg/ml streptomycin, 50 µg/ml gentamycin, 20 µg/ml ciprofloxacin, 10 mmol/l HEPES and 1.2 mg/ml nicotinamide. Donor characteristics are listed in electronic supplementary material (ESM) Table 1. Donors were considered to have type 2 diabetes if a history of diabetes was recorded, and/or the HbA1c level was >48 mmol/mol (6.5%) and there was no indication of other types of diabetes mellitus. Donors were considered to have prediabetes if the HbA1c level was between 39 mmol/mol (5.7%) and 46 mmol/mol (6.4%), according to the ADA guidelines [31].

The EndoC-βH1 cell line [32] was obtained from Univercell Biosolutions (Toulouse, France). Cells were seeded in ECM/fibronectin coated plates and cultured with low glucose DMEM (Invitrogen, USA) supplemented with 10 mmol/l nicotinamide, 5.5 g/ml transferrin, 6.7 ng/ml selenite, penicillin-streptomycin and 50 μmol/l β-mercaptoethanol.

HEK293T cells (ATCC, CRL-3216) were cultured in DMEM + 10% FCS. All cell lines are regularly checked for potential mycoplasma infection in our laboratory.

Induction of stress conditions

Human islets were exposed for 24 h or 72 h to 1 ng/ml IL-1β (401-ML, R&D systems) + 50 ng/ml IFNγ (285-IF, R&D systems, USA) (cytokines). EndoC-βH1 cells were treated for 24 h or 72 h with 1 ng/ml IL-1β + IFNγ 50 ng/ml (cytokines), 1, 2 or 4 µmol/l baricitinib (a JAK–STAT inhibitor, HY-15315, MedChemExpress, USA) and 1, 2.5 or 5 µmol/l Bay 11-7082 (196871, Merck, Germany) or 50 µg/ml salicylate (S3007, Merck) (NF-κB inhibitors).

Single-cell RNA-sequencing

We used our single-cell RNA-sequencing Gene Expression Omnibus (GEO; www.ncbi.nlm.nih.gov/geo/) dataset generated from human pancreatic islets treated with beta cell stressors (GSE218316) and performed a differential gene expression analysis of human islet cells treated with IL-1β + IFNγ using a Wilcoxon rank-sum test. We considered genes to be significantly altered if they had an adjusted p value (based on Bonferroni correction) <0.05.

Transcriptomic analysis of type 2 diabetes datasets

Four previously published SMART-seq (GEO GSE83139 [33], GSE81608 [34]) or SMART-seq2 (GEO GSE81547 [35], European Bioinformatics Institute E-MTAB-5061 [36]) scRNA-seq datasets of human pancreatic islets were selected for analysis. Differential gene expression in islets from donors without diabetes and with type 2 diabetes was statistically computed using an unpaired t test. See ESM Methods section for details.

Cell-death staining

Cell death was assessed by using the ReadyProbes Cell Viability Imaging Kit (R37610, Thermo Fisher, USA). EndoC-βH1 cells were incubated with propidium iodide (PI) and Hoechst 33342 for 20 min and imaged with the ImageXpress confocal microscope (Molecular Devices, USA). Blinded quantification was performed with Fiji (2016, https://imagej.net/software/fiji/downloads) by using a nucleus-counting macro.

RT-qPCR

RNA (250–500 ng) was obtained from human islets and EndoC-βH1 cells by cell lysis with RLT buffer with β-mercaptoethanol according to the manufacturer’s instructions (micro RNeasy kit from Qiagen, Hilden, Germany). Isolated RNA was reverse-transcribed to DNA with M-MLV reverse transcriptase (Invitrogen), oligo(dT)s (Qiagen), dNTP (Promega, USA), DTT (Invitrogen) and RNAse-OUT (ThermoFisher). Quantitative PCR (qPCR) was performed with IQ SYBR green mix (170–8887, Bio-Rad, Hercules, USA). GAPDH and ACTB were used as housekeeping genes. Amplification and detection were performed by using CFX systems (Bio-Rad) and fold changes were obtained by using the \(^}_}}\) method. Primers are included in ESM Table 2.

Immunohistochemistry and fluorescence microscopy

Coverslip-cultured EndoC-βH1 cells, isolated human islets or pancreatic tissue samples were fixed in 4% formaldehyde solution and embedded in 2% agar and paraffin. Samples were sectioned into 4 μm slides using the Leica microtome (RM2255, Leica, Germany). Slides were deparaffinised and rehydrated. Blocking was done with 5% normal donkey serum followed by primary and secondary antibody incubations. For nuclei staining, an extra step with 1% Triton X-100 was performed. Immunofluorescence was detected with a Leica microscope (Leica SP8). Antibodies used are listed in ESM Table 3.

Western blotting

After treatment, approximately 3.000 islet equivalents or 350.000 EndoC-βH1 cells were washed with cold PBS and lysed in RIPA lysis and extraction buffer with 1/100 protease and phosphatase inhibitor (Thermo Fisher). Lysates were passed ten times with a 26-gauge needle and centrifuged to obtain the supernatant. Protein content was measured by BCA protein content kit (Thermo Fisher) and 10–20 μg protein was loaded in 12% mini-PROTEAN TGX gels (Bio-Rad) and transferred to 0.2 µmol/l PVDF membranes (Trans-blot turbo mini 0.2 µmol/l PVDF transfer packs, Bio-Rad). Membranes were blocked with 5% Milk in PBS-Tween for 1 h, incubated with primary antibody overnight at 4°C, and after three washes with PBS-Tween, incubated for 1 h with secondary antibody at room temperature. Primary and secondary antibodies were diluted in the same buffer as the one used for blocking the membrane. Blots were incubated with Supersignal West Pico PLUS Chemiluminescent substrate (Thermo Fisher), visualised with Bio-Rad ChemiDoc Touch (Bio-Rad) and analysed with Image Lab (version 6.1, Bio-Rad). Antibodies used are listed in ESM Table 3.

Lentivirus-mediated overexpression and knockdown

For overexpression, open reading frames (ORFs) of APOL1 and APOL2 in pDONR223 vector were picked from the MISSION TRC3 Human LentiORF Collection (Sigma-Aldrich), amplified by PCR using the following primers: APOL1 forward (XhoI): TTCTCGAGATGGAGGGAGCTG; APOL1 reverse (XbaI): AATCTAGAGGCTTGTGTCCACC; APOL2 forward (XhoI): TTCTCGAGATGAATCCAGAGAGC; APOL2 reverse (XbaI): AATCTAGATTGGTCTTGGCCTGGC; and subsequently subcloned into pLV-CMV-IRES-puro vector (XhoI/XbaI) for expression. All constructs were verified by sequencing.

The shRNA lentiviral constructs against APOL1, APOL2 and APOL6 were obtained from the MISSION shRNA library (clones TRCN118633, TRCN83107, TRCN151077, Sigma-Aldrich) and produced as described previously [37].

For transduction, EndoC-βH1 cells were infected with a multiplicity of infection (MOI) of 1 in DMEM/polybrene overnight. After, cells were washed in PBS and replaced with fresh DMEM for 48 h or 72 h, for overexpression or knockdown experiments, respectively.

siRNA-mediated knockdown

EndoC-βH1 cells were transfected overnight with 30 nmol/l siRNA targeting human STAT1 (ON-target SMARTpool human siSTAT1, L-003543-00, Horizon Discovery, Cambridge, UK), or non-target control (ON-TARGETplus Non-targeting siRNAs, D-001810-01, Horizon Discovery). Transfection was performed with Dharmafect transfection reagent (Horizon Discovery) as described in the manufacturer’s instructions. After 48 h, cytokines were added for 24 h.

Statistics

Results are represented as mean ± SEM. Comparisons were performed by two-tailed student t test and a p value <0.05 was considered significant.