Cell lines

Human AML cell lines were purchased from DSMZ (Braunschweig, Germany). Cas9-Blast or deadCas9-Blast (dCas9) cell lines are subclones of the respective cell lines and stably transduced with lentiCas9-Blast (Addgene #52962) or dCas9-VP64-Blast (Addgene #61425) and MS2-P65-HSF1-Hygro (Addgene #61426). MV-4;11 M327I and MV-4;11 T349M have been previously described [33]. Cells were cultured in RPMI 1640 medium (Thermo Fisher Scientific, Waltham, USA) supplemented with 10-20% FBS (Thermo Fisher Scientific) in 5% CO2 at 37°C.

Animal studies

All mice were housed under pathogen-free conditions in the Animal Research Facility of the Otto-von-Guericke University Medical Faculty Magdeburg, the ZET (University Hospital Jena) and ZTL (University Medicine Greifswald). All experiments were conducted after approval by the respective authorities of Sachsen-Anhalt (42502-2-1279 UniMD), Thüringen (02-030/2016) and Mecklenburg-Vorpommern (7221.3-1-019/22). Conventional LMP7 -/- and i-KMT2A::MLLT1 mouse models have been previously published [24, 45]. For induction of KMT2A::MLLT1 expression in the i- KMT2A::MLLT1 model, mice were treated for 2 weeks with food supplemented with Doxycycline (DOX; 0.545 g/kg). For induction of KMT2A::MLLT3 driven leukemia we used established retroviral MSCV-GFP-based vectors to express KMT2A::MLLT3 in hematopoietic stem- and progenitor cells (Lineage-Sca1+c-Kit+, LSK cells) as described before. For competitive repopulation assays of normal hematopoiesis, 2x106 BM cells of 6-8-weeks old B6.SJL-PtprcaPepcb/BoyCrl (CD45.1) or C57BL/6JRj (CD45.2) animals (Janvier Labs) and 2x106 (CD45.1/2) competitor cells (derived from intercrossing B6.SJL-PtprcaPepcb/BoyCrl (Charles River) with C57BL/6JRj (CD45.2) animals) were transplanted via lateral tail vein injection into lethally irradiated (13 Gy, single-dose) 6-8-weeks old C57BL/6JRj (CD45.2) recipient mice or B6.SJL-PtprcaPepcb/BoyCrl (CD45.1) (females), respectively.

Primary patient samples

Primary AML patient samples and healthy donor controls were obtained after informed consent and according to the Helsinki declaration within the AML-trials of the German-Austrian AMLSG study group and from the Hematology Tumor Bank Jena and Magdeburg, approved by the respective local ethics committee (Ethics Committee of the Medical Faculty, University Hospital Jena #4753/04-16 or University Hospital Magdeburg #115/08). Human bone marrow aspirates were separated with Ficoll-Paque Plus (GE Healthcare, Chicago, IL, USA) following the manufacturer`s instruction and cryopreserved in 1x freezing medium (80% FBS + 10% DMSO + 10% IMDM medium).

Mouse xenotransplantation

NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(CMV-IL3, CSF2, KITLG) 1Eav/MloySzJ (NSGS) mice were obtained from The Jackson Laboratory (Bar Harbor, ME, USA). NOD.Cg-Prkdcscid Il2rgtm1Wjl/RJ (NXG) mice were obtained from Janvier (Le Genest-Saint-Isle, France). 8-12-weeks old adult mice (male and female) were irradiated with 2 Gy (single dose) before transplantation. 1x105 MOLM-13, ML-2 or MV-4;11 cells transduced with either of two PSMB8 shRNAs or non-targeting control; with a pLEX vector containing the sequence of BASP1 or an empty vector; or treated ex vivo with the indicated inhibitors were injected intravenously via the tail vein. For patient derived xenograft experiments (PDX) of human KMT2Ar leukemia, 1-5x104 cells from patient samples containing an KMT2A::MLLT3or KMT2A::AFF1 translocation were injected into NOD.Cg-KitW-41JPrkdcscidIl2rgtm1Wjl/WaskJ (NSGW41) [46]. Human myeloid engraftment (hCD45+) was analyzed by flow cytometry.

In vivo drug treatment

PR-957 (MedChemExpress, Monmouth Junction, NJ, USA) was solved in DMSO and diluted in CAPTISOL® from a sterile stock solution and administered by i.v. injections (3mg/kg, 6mg/kg or 10mg/kg as indicated) once daily as published before [20]. NaCl0.9% was injected as diluent control. MI-503 (Selleckchem, Houston, TX, USA) was dissolved in 25%DMSO/25%PEG-400/50%NaCl0.9% or a diluted solution of DMSO in CAPTISOL®and administered i.p. at 50mg/kg versus NaCl0.9% or 30%DMSO-70%NaCl0.9% as diluent control.

Methylcellulose colony-forming assays

Primary mouse bone marrow (BM) cells (transduced with MA9/KRAS, MA6 or AML1-ETO/KRAS) were seeded in MethoCult GF M3434 (Stemcell Technologies, Vancouver, Canada) at a concentration of 1x103 cells/replicate. LSK cells isolated from LMP7 -/- or LMP7 +/+mice (transduced with KMT2A::MLLT3 or KMT2A::MLLT1) were seeded at 500 cells/replicate. Colonies propagated in culture were scored on day 7 and replated for 4 weeks. For re-plating of BM cells, colonies were harvested from the methylcellulose medium, washed with PBS/1%FBS and re-seeded at the same concentration. Human AML cell lines infected with either NT or PSMB8-specific shRNAs were plated at 250 cells/replicate in MethoCult H4230 (Stemcell Technologies) supplemented with 10% FBS. Colony numbers were counted on day 10-14.

Immunohistochemistry

Spleen, liver and lung were fixed in 4% paraformaldehyde for 24 hours followed by incubation in 30% ethanol for 30 min and 50% ethanol for 24 hours. Organs were embedded in paraffin and paraffin sections were cut on a rotary microtome (Microm HM 355S, Thermo Fisher Scientific), mounted on microscope slides and air-dried in an oven at 37°C overnight. Tissue section slides were then processed automatically for H&E staining (Leica AutoStainer XL, Leica Biosystems, Wetzlar, Germany). Images were acquired at 10x magnification on an AxioImager A.2 (Carl Zeiss Microscopy, Jena, Germany). Images were processed using the ImageJ software (NIH, Bethesda, MD, USA).

Flow cytometry and antibody staining

Immunophenotyping of immature and mature cell compartments and of leukemic cells was performed as described before [19]. The antibodies used for cell surface staining are provided in Table S1. Cells were stained in PBS/1% FBS for 1.5 hours at 4°C. SYTOX®Blue Dead Cell Stain (Life Technologies, Darmstadt, Germany) was used to exclude dead cells. Flow cytometry was performed on a LSRFortessa or FACS Canto II cytometer (BD Biosciences, Franklin Lakes, NJ, USA). Cell cycle analysis was performed using the Click-iT™ EdU Alexa Fluor™ 647 Assay Kit (Thermo Fisher Scientific) as per the manufacturer`s instructions.

Genetic inactivation by RNAi

The pLKO.1-vector system with puromycin resistance gene was used. HEK293T cells were transfected using FUGENE®HD Transfection Reagent (Promega, Madison, WI, USA) to generate lentiviral particles as described before [19]. Target cells were infected twice (8 hours gap) by spinfection (872g, 1.5 h, 33°C). Puromycin selection (1 µg/ml) was started at 48h. shRNA sequences are provided in Table S2.

CRISPR activation

Guide RNAs were designed using the CRISPick tool (Broad Institute, https://portals.broadinstitute.org/gppx/crispick/public). sgRNA sequences: Luciferase_sgRNA (GATTCTAAAACGGAT-TACCA), sgRNA3a BASP1 (CGGGGAGCGCGGGAGGAGGG), sgRNA5a BASP1 (GGGCGGGGAGCGCGG-GAGGA). For cloning sgRNA sequences, the improved-scaffold-pU6-sgRNA-EF1Alpha-PURO-T2A-RFP (ipUSEPR) vector system was used. HEK293T cells were transfected using FUGENE®HD Transfection Reagent (Promega, Madison, WI, USA) to generate lentiviral particles as described before [19]. Cell lines stably expressing Cas9 were infected twice (8 hours gap in between) by spinfection (872xg, 1.5 hours, 33°C). The cells expressing sgRNAs were selected with 1 µg/ml puromycin starting on day 2 post-infection. Cells were collected for RT-qPCR on day 8 post-infection

Cellular proliferation & apoptosis

Cellular proliferation was assessed by cell counting using Trypan Blue exclusion. Apoptosis was measured by flow cytometry using Annexin V/ SYTOX®Blue staining.

Genome-wide CRISPR/Cas9 screening

6x108 MOLM-13 cells were transfected (872 g, 37C, 2h) with lentiviral particles containing the human lentiviral CRISPR/Cas9 library (developed and kindly provided by Dr. X. S. Liu (Addgene, #1000000132)). Cells were treated for 12 days with increasing concentrations of PR-957 (50-200nM) or DMSO as a control. Genomic DNA was extracted, and library amplification performed according to standard protocols (https://www. addgene.org/pooled-library/liu-crispr-knockout/).

Quantitative real-time PCR

1µg of total RNA were extracted using TRIzol Reagent (Thermo Fisher Scientific,) or the RNeasy Mini Kit (Qiagen, Hilden, Germany). RNA was reverse-transcribed using Omniscript RT Kit (Qiagen, Hilden, Germany) as per the manufacturer`s instructions and complementary DNA samples were analyzed by RT-qPCR using SYBR® Premix Ex TaqII™ (Clontech Laboratories, Mountain View, CA, USA) following the manufacturer’s instruction. Gene-specific primers were designed to span exon-exon boundaries. All expression values were normalized and standardized using the Bio-Rad CFX Manager software (Munich, Germany) and presented as fold changes of gene expression in the test sample compared to the control. Primer sequences are listed in Table S4.

Protein extraction and immunoblotting

Cells were washed twice with ice-cold PBS and lysed in lysis buffer (50 mM HEPES pH7.4, Glycerol 10%, NaCl 150 mM, TritonX-100 1%, MgCl 1.5 mM, EGTA 5mM) for 1 hour on ice. For nuclear extraction, NE-PER™ Nuclear and Cytoplasmic Extraction Kit (Thermo Fisher Scientific) was used following the manufacturer´s instructions. Protein concentration was calculated using the Protein Assay Dye Reagent Concentrate (Bio-Rad Laboratories, Inc., Hercules, CA, USA) following the manufacturer’s instruction. HRP-conjugated anti-rabbit or anti-mouse secondary antibodies were purchased from Cell Signaling (Denvers, MA, USA). Primary antibodies used included: anti-BASP1 (Thermo Fisher Scientific, 703692), anti-c-Myc (Abcam, Cambridge, UK; ab32072), anti-FLT3 (Cell Signaling, CS3462), anti-GAPDH (Meridian Life Sciences, Cincinnati, OH, USA; H68504M), anti-HA-Tag (Cell Signaling, CS3724), anti-HDAC1 (Cell Signaling, CS5356), anti-MEF2C (Cell Signaling, CS5030S), anti-PBX3 (Abcam, ab109173), anti-PSMB5 (Santa Cruz Biotechnology, Dallas, TX, USA; sc393931), anti-PSMB8/LMP7 (Abcam, ab3329 / Santa Cruz Biotechnology, sc365699), anti-PSMB9/LMP2 [47], anti-PSMB10/MECL1 (Thermo Fisher Scientific, PA5-19146), anti-Vinculin (Sigma Aldrich, St Louis, MO, USA; V9131), anti-β-actin (Santa Cruz Biotechnology, sc47778).

Global proteome analysis

For global proteome profiling, leukemia development was initiated with KMT2A::MLLT3 (or AML1-ETO as control) containing MSCV-GFP constructs. Murine stem-and progenitor cells (LSK cells: Lin-Sca+c-Kit+) from 6-8 weeks-old C57BL/6J donors (females) were sorted and infected by co-localization of virus supernatant (containing one of the oncogenes) on retronectin-coated plates. 72 hours after infection equal numbers of GFP+ cells were injected into sublethally irradiated recipient hosts (7Gy). 2x 105 LSC-enriched (GFP+ c-Kit+) cells (4 replicates per oncogene) were sorted directly into 2x lysis buffer (for a final concentration: 1% SDS, 50 mM HEPES, pH 8.5, 10 mM DTT; volume of lysis buffer added to collection tube was estimated to be equal to the volume of the sheath buffer). For global proteome profiling of human AML cell lines, 2x106 cells treated with 100nM PR-957 or DMSO, 72h (4 replicates per treatment). Sample processing was performed as described previously [48].

ATAC-sequencing

5x104 MOLM-13 cells were used for nuclear extraction. Nuclear fractions were tagmented using Illumina Tagment DNA TDE1 Enzyme and Buffer Kit (New England Biolabs® (NEB), Ipswich, MA, USA). Subsequently, DNA was extracted using the DNA Clean & Concentrator-5 (Zymo Research, Irvine, CA, USA). DNA was mixed with a universal i5 and uniquely barcoded i7 primer and amplified using NEB-Ultra II Q5 master mix (New England Biolabs, M0544S) in a thermocycler using the following conditions: 98°C for 30 seconds; 7 cycles of 98°C for 10 seconds, 63°C for 30 seconds; and 72°C for 1 minute. Post amplification libraries were size selected at >250bp in length using SPRI-select beads (Beckman Coulter, Brea, CA, USA). Library fragment length was checked by HSD5000 Tape (Agilent, Santa Clara, CA, USA) and DNA concentration was determined by the Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific).

Cut & Tag-sequencing

Protein A fused to Tn5-transposase was expressed and purified using a publicly available construct (Addgene #124601). In brief, 1x105 MOLM-13 cells were washed in Wash Buffer (20 mmol/L HEPES pH 7.5, 150 mmol/L NaCl, 0.5 mmol/L Spermidine, protease inhibitor cocktail) and bound to Concanavalin A beads (Bangs Laboratories, Fishers, NC, USA; BP531). Cells were resuspended in 50μL Digitonin Wash Buffer (20 mmol/L HEPES pH 7.5, 150 mmol/L NaCl, 0.5 mmol/L Spermidine, protease inhibitor cocktail, 2 mmol/L EDTA, 0.05% Digitonin) and incubated with anti-H3K4me3, -H3K4me1, -H3K27ac, -and H3K27me3 antibody at a 1:100 dilution overnight at 4°C. Beads were resuspended in 100μL Digitonin Wash Buffer with a secondary antibody diluted 1:100 and incubated for 30min at room temperature.  Cells were washed three times in Digitonin Wash Buffer and resuspended in Digitonin-300 Buffer (0.05% Digitonin, 20 mmol/L HEPES, pH 7.5, 300 mmol/L NaCl, 0.5 mmol/L Spermidine, protease inhibitor cocktail) containing 1:250 pA-Tn5 transposase and incubated at room temperature for 1 hour. Subsequently, cells were washed three times in Digitonin-300 Buffer and resuspended in 100 μL Tagmentation Buffer (10 mmol/L MgCl2 in Digitonin-300 Buffer) and incubated at 37°C for 1 hour. Tagmentation was stopped by adding 10μL of 0.5 M EDTA, 3μL of 10% SDS, and 2.5 μL of 20 mg/mL Proteinase K (Thermo Fisher Scientific, 25530049), and samples were incubated 37°C overnight. Tagmented DNA was purified using AMPureXP-beads (Beckman Coulter). For each sample, 21μL DNA was mixed with a universal i5 and uniquely barcoded i7 primer and amplified using NEBNext High Fidelity 2x PCR Master Mix (New England Biolabs, M0541S) in a thermocycler using the following conditions: 98°C for 30 seconds; 14 cycles of 98°C for 10 seconds, 63°C for 10 seconds; and 72°C for 2 minutes. DNA was purified with AMPureXP beads and quality was assessed by the Qubit dsDNA HS Assay Kit and HSD5000 Tape.

Cut & Run-sequencing

6x105 MOLM-13 cells were harvested per reaction. Preparation of the samples was performed using CUTANATM ChIC/CUT&RUN Kit (EpiCypher, Chapel Hill, NC, USA) following the manufacturer´s instructions. Antibodies used: anti-BASP1 (Thermo Fisher Scientific, 703692), IgG Control (EpiCypher, 13-0042k) and H3K4me3 (positive control) (EpiCypher, 13-0041k). Library amplification was done using the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB) using 6ng of sample. Post amplification libraries were size selected at 150-250bp in length using AMPure beads (Beckman Coulter). Library fragment length was checked by HSD1000 Tape and DNA concentration was determined by Qubit.

Statistics and analysis of sequencing and proteome data

Statistical analyses were performed using Student’s ttest or 2-way ANOVA (normal distribution) or Mann-Whitney U test (when normal distribution was not given). pless than 0.05 was considered statistically significant. mRNA expression data of the catalytic (immuno-) proteasome subunits in different genetic AML subtypes was downloaded from BloodSpot data base [49] (http://servers. binf.ku.dk/bloodspot/) and protein expression data from depmap.org. Detailed information on the analyses of proteome, RNA-, ATAC-, Cut&Tag-, Cut&Run-sequencing data is provided in the Supplementary Material and Methods.