Animals

Male and female SHR (12–13 weeks of age) were purchased from Envigo Laboratories (Indianapolis, IN). SHR were selected for the current study based on our previous work showing that SHR exhibit a sex difference in renal recovery 7-days post-IR (Mohamed et al. 2022), which allows us to study sex specific mechanism mediating renal post-IR. Rats were housed in temperature (20–26 °C) and humidity (30–-70%) controlled, 12:12 h light-cycled conventional animal quarters. Rats were provided ad libitum access to water and standard 18% protein rodent chow (Envigo Teklad, 2918). The Institutional Animal Care and Use Committee of Augusta University approved all of the protocols and procedures using animals (approval number 2014-048).

Warm bilateral renal ischemia reperfusion

Rats (n = 5–6) were anesthetized with ~ 2% isoflurane and placed on a heating pad to maintain body temperature at 37 °C. The left and right kidneys were accessed by flank incisions. The kidneys were exposed, and both renal arteries were carefully separated from the renal vein via manual blunt dissection and clamped with microserrefines (Fine Science Tools, Foster City, CA) for 30 min as previously reported (Mohamed et al. 2020). The duration of the ischemic insult was chosen based on previous studies where 15 min of renal ischemia resulted in minimal injury and 45 min of ischemia resulted in ~ 80% mortality within 3 days in SHR (Crislip et al. 2020). Reperfusion of the kidney was confirmed visually upon release of the clamps. As a control, sham-operated animals were subjected to the same surgical procedure except the renal arteries were not clamped. Surgical wounds were closed using 4 − 0 polypropylene suture and wound clips. Rats were given 1 ml of warm saline, intraperitoneal to replace any fluid loss. Rats were kept warm until they regained consciousness and buprenorphine (0.9 mg/kg sc) was administered as an analgesic. Rats were allowed to recover for 1 or 7 days in conventional animal housing before being deeply anesthetized with ~ 2% isoflurane. The depth of anesthesia was checked by tail pinch and pedal reflex before a midline incision was made. A terminal blood sample was collected from the abdominal aorta as rats were rapidly exsanguinated, followed by a thoracotomy. Kidneys were harvested for histological and biochemical analyses.

To assess the role of 12/15 LOX in recovery from renal IR, additional male and female SHR (n = 5–6) were randomized to receive intraperitoneal injection of the specific 12/15 LOX inhibitor ML355 (30 mg/kg body weight) or vehicle (saline + 0.02% DMSO) 1 h prior to sham/IR surgery and every other day up to 7 days post-IR (Adili et al. 2017). The dose of ML355 was chosen based on pre-experimental screening and route of administration was chosen based on published literature (Adili et al. 2017). Blood samples were collected at baseline and 1-day post-IR via tail vein puncture. Animals were allowed to recover for 7 days in conventional animal housing before being anesthetized with ~ 2% isoflurane as described above. A terminal blood sample and kidneys were harvested.

Blood pressure (BP) measurement

To determine whether IR surgery or 12/15 LOX inhibition affected BP, systolic BP was measured at baseline, 1-, 3- and 7-days post-IR in vehicle- and ML355-treated male and female SHR using tail cuff as described previously (Tipton et al. 2014; Pollock and Rekito 1998). Rats were acclimated to the tail cuff technique for three consecutive days before baseline data collection. The systolic BP of each rat was determined by the average of five independent readings with at least a 1-minute break between each inflation of the pressure cuff.

Biochemical measurementsAssessment of renal function

Plasma and urine creatinine concentrations and blood urea nitrogen (BUN) were measured using commercially available kits (BioAssay Systems, Hayward, CA; Quantichrome Creatinine Assay Kit, Cat# DICT-500, Lot number CA04A06; Quantichrome Urea Assay Kit, Cat # DIUR-100, Lot number CA02A12)(Crislip et al. 2017).

Measurement of 12/15 LOX activity

Activity of 12/15 LOX was evaluated by measuring the amount of the major metabolic product of 12/15 LOX, 12-HETE in the plasma by ELISA (Abcam, USA) and 12-HETE and 15-HETE in the kidney by LC/MS. Renal HETE levels were measured in the Lipidomics Core Facility at Wayne State University (Detroit, MI) as previously described (Othman et al. 2013; Maddipati and Zhou 2011; Maddipati et al. 2014). Briefly, 2 mg of kidney homogenate was adjusted to a maximum volume of 1 ml and spiked with a mixture of internal standards consisting of 15(S)-HETE-d8, Leukotriene B4-d4, Resolvin D2-d5, 14(Cole et al. 2012)-EpETrE-d11, and prostaglandin E1-d4 (5 ng each) and mixed thoroughly. Samples were then extracted for PUFA metabolites using C18 extraction columns as previously described (Maddipati and Zhou 2011; Maddipati et al. 2014). Briefly, the internal standard spiked samples were applied to conditioned C18 cartridges, washed with water followed by hexane, and dried under vacuum. The cartridges were eluted with 0.5 ml methanol. The eluate was dried under a gentle stream of nitrogen. The residue was re-dissolved in 50 μl methanol-25 mM aqueous ammonium acetate (1:1) and subjected to LC-MS analysis performed on a Prominence XR system (Shimadzu) using Luna C18 (3 μ, 2.1 × 150 mm) column. The data were collected using Analyst 1.5.2 software and the Multiple Reaction Monitoring (MRM) transition chromatograms were quantitated by MultiQuant software (both from ABSCIEX). The internal standard signals in each chromatogram were used for normalization, recovery, and relative quantitation of each analyte. The average recovery using this procedure was > 90%. 12/15 HETE metabolite concentrations were normalized to the initial kidney weight and levels were directly compared between male and females.

Lipid peroxidation

The extent of lipid oxidation in the kidney and plasma were evaluated by measuring malondialdehyde (MDA) concentrations using thiobarbituric acid reactive substances (TBARS) assay kit (Cayman Chemical) according to manufacturer instruction.

TNF-α measurement

Plasma levels of TNF-α were measured using a commercial ELISA assay according to the manufacturer instructions (Abcam, Cambridge, MA).

Western blot analysis

Thirty μg of renal cortex was isolated, homogenized, and used for Western blot analysis as previously described (Mohamed et al. 2022; Sasser et al. 2007). Briefly, the homogenate was resolved on 4–20% Tris-glycine-SDS gels (Bio-Rad, Hercules, CA) and proteins were transferred to PVDF membranes (MilliporeSigma, Burlington, MA). Protein expression was determined with two-color immunoblots using primary antibodies to GPR78 (cat# ab21685; 1:1000 dilution, Abcam, USA), phosphorylated PERK (cat# 3179 S; 1:1000 dilution, Cell Signaling Technology, USA), total PERK (cat# 3192 S; 1:1000 dilution, Cell Signaling Technology, USA) and CHOP (cat# 28,955; 1:1000 dilution, Cell Signaling Technology, USA). Specific protein bands were detected using an Odyssey infrared imager (LI-COR Biosciences, Lincoln, NE) with AlexaFluor 680 and IRDye800 (Molecular Probes, Eugene, OR) conjugated secondary antibodies. Protein concentrations were determined by standard BCA reagent (Thermo Scientific) using BSA as the standard. Protein loading was normalized to β-actin (Sigma, St. Louis, MO) consistent with standard laboratory practice.

Histological assessment of tubular injury

Kidneys were bisected transversely with a razor blade, fixed in buffered 10% formalin overnight and then embedded in paraffin wax. For assessment of renal tubular injury, 5 μM sections were stained with hematoxylin and eosin (H&E) following the protocol provided by the manufacturer (Leica Biosystems; Buffalo Grove, IL). Renal tubular injury was quantified by an investigator blinded to the hypothesis and the rat sex and treatment by assigning a score based on the percentage of renal tubules showing epithelial cell necrosis, brush-border loss, cast formation, and apoptotic bodies (Mohamed et al. 2022, Ranganathan et al. 2013). Renal tubular injury scores were assessed based on the following scale indicating the percentage of tubules showing signs of injury: 0 = normal; 1 = < 25%; 2 = 25–50%; 3 = 51–75%; 4 = > 75%. 10 fields at 20X magnification were examined and data were averaged for each animal. Stained sections were photographed using an Olympus BX40 microscope (Olympus America, Melville, NY) on a bright-field setting fitted with a digital camera (Olympus DP12; Olympus America).

TUNEL staining

TUNEL staining was performed to assess cell death in renal tissue slices using the ApopTag plus Peroxidation in situ Apoptosis Detection kit according to the manufacturer instructions (EMD Millipore; cat # S7101). Briefly, 5 μM kidney sections were deparaffinized, hydrated, and washed with PBS. Sections were digested with proteinase K for 15 min at 24 °C. Slides were then washed with PBS, and endogenous peroxidase activity was quenched with 3% H2O2 in methanol. Slides were washed again and incubated with TdT labeling reaction mix at 37 °C for 1 h and then with anti-digoxigenin peroxidase. The color was developed using peroxidase substrate solution. Slides were washed, counterstained, and mounted with Permount. TUNEL positive cells were counted and quantified by an investigator blinded to the hypothesis, rat sex and treatment. Brown nuclei indicate TUNEL-positive cells.

Macrophage immunostaining

To quantify renal macrophage infiltration, formalin-fixed kidneys were sectioned and 5 μM sections were incubated in the absence or presence of primary antibodies to the macrophage marker CD68 (R&D, cat #; 1:400 dilution) in humidified chambers overnight at 4 °C. The next day, kidney sections were washed with phosphate buffer saline (PBS) and incubation with HRP-conjugated donkey anti-rabbit IgG (Jackson ImmunoResearch Laboratories, West Grove, PA) for 1 h at room temperature. Color was developed after incubation with DAB reagent (Vector Lab, Burlingame, CA). Macrophages were quantified by an investigator blinded to the hypothesis, rat sex and treatment utilizing 10 fields at 20X magnification. Brown nuclei indicate CD68-positive cells macrophages.

Real-time quantitative reverse transcriptase PCR

Total RNA was extracted from snap-frozen kidney cortex using RNeasy Mini Kits (Qiagen, Germantown, MD) according to the manufacturer protocol as described previously (Mohamed et al. 2016). RNA (2 μg) was reverse transcribed to complement DNA using iScript. Reverse Transcription Supermix for RT-qPCR (BioRad, Hercules, CA). The product was diluted to a volume of 150 μl, and 5 μl aliquots were used for amplification. Real-time PCR was performed on a StepOne real-time instrument (Applied Biosystems, Foster City, CA) using iTaq Universal SYBR Green Supermix (BioRad, Hercules, CA) and gene specific primers from IDT: rat 12 LOX 5’TGGCTAAGATCTGGGTCCGA3’; 5’AACGGATGTGCGGAACTAGG3’), rat TNF-α (5’AAATGGGCTCCCTCTCATCAGTTC3’; 5’TCTGCTTGGTGGTTTGCTACGAC3) or Qiagen: rat IL-1β (Cat # QT00181657) and rat IL-6 (Cat # 330,001). The amount of DNA was normalized to the rat GAPDH signal amplified in a separate reaction (Cat # QT00199633).

Statistical analysis

All data are presented as mean ± SEM. Statistical analyses were performed using GraphPad Prism version 9.0 software (GraphPad Software, La Jolla, CA). Same group comparisons were carried out using repeated measure ANOVA. Multiple group comparisons and sex comparisons were carried out using two-way ANOVA. P < 0.05 was considered as significantly different.