Bacterial isolation and identification

E. faecalis was isolated from different food samples including cheese, vegetables, yogurt, and milk following the method described previously (Chingwaru and Gashe 2003). Briefly, 25 g of samples were mixed with 225 ml of peptone water in a stomacher bag and homogenized for 2 min. After that, samples were serially diluted, and 0.1 ml of each sample was spread on the surface of bile esculin azide agar media (BEA, Sigma-Aldrich, St Louis, MO). For milk samples, 1 ml of milk was added to 9 ml of 0.1% peptone water (Oxoid, UK) in a sterile test tube and 0.1 ml of each dilution was inoculated onto BEA media. The inoculated plates were incubated at 37 °C for 24 h. The identity of the bacterial isolates and further confirmation by the polymerase chain reaction (PCR) was done. The PCR amplification of the 16 S rRNA gene was carried out using the following primers; Forward: AGAGTTTGATCCTGGCTCAG and reverse: GGTTACCTTGTTACGACTT. The PCR mixture included 5 µL Go Taq Green Master Mix×2 (Promega, Madison, WI, USA), 1 µl of each primer, 1 µl of template DNA, and 3 µL distilled water. The TaKaRa PCR Thermal Cycler Dice (Takara Bio Co., Tokyo, Japan) was used to conduct the reactions. The condition of the PCR was as follows: denaturation at 95 °C for 5 min, 30 cycles of denaturation at 94 °C for 30 s, annealing at 51 °C for 30 s, and extension at 72 °C for 90 s, and a final extension at 72 °C for 5 min, and hold at 4 °C. The amplified products were electrophoresed on a 1.5% gel and stained with Midori Green Advance DNA stain (Nippon Genetics Co., Ltd., Tokyo, Japan), and LuminoGraph 1 (ATTO Co., Ltd., Tokyo, Japan) was used to visualize the DNA. The PCR products were then purified using a PCR purification kit (Nippon Genetics) and sequenced for confirmation of isolates by comparing the sequence of the 16 S rRNA gene to those of E. faecalis or E. faecium in the database.

Detection ofE. faecalisvirulence genes.

A total of three genes encoding virulence factors including aggregation substance (Asa1), collagen-binding protein (ace), and E. faecalis endocarditis antigen (efaA) were detected using PCR as described before (Creti et al. 2004). The specific primers, amplicon sizes, and targeted genes are listed in Table S1 The reaction of each gene was performed in a final volume of 25 µl using a TaKaRa PCR Thermal Cycler Dice. The amplified products were electrophoresed on a 1.5% gel and visualized as mentioned described above.

Antibiotic susceptibility profile of E. faecalis

The antimicrobial susceptibility to 9 antibiotics was performed using the disk diffusion method according to the Clinical and Laboratory Standards Institute 2021 recommendations (CLSI). The antibiotic disks include penicillin (PEN), erythromycin (EM), gentamycin (GM), kanamycin (KM), rifampin (RM), vancomycin (VCM), ampicillin (ABP), amoxicillin-clavulanic acid (ACV), and ciprofloxacin (CIP). Briefly, 0.1 ml from overnight bacterial culture after dilution aseptically in TSB (optical density at 600 nm (OD600) value = 0.2) was swabbed using sterile cotton swabs on Müller-Hinton agar plates (Nissui Pharmaceutical Co., Ltd., Tokyo, Japan), and antibiotic disks were aseptically added on the surface of the plates using sterile forceps, and the inoculated plates were incubated at 37 °C for 24 h. The results were interpreted as susceptible (S), intermediate resistance (IR), and resistant (R) according to CLSI guidelines (CLSI 2021).

Biofilm formation assay

The ability of E. faecalis isolates to form biofilms was estimated using the 96-microtiter plates method (Stepanoviće et al., 2007). Briefly, 200 µl of the bacterial culture (OD600 ~ 0.4) was inoculated in the wells of the plates and incubated for 24 h. After that, the wells were washed 3 times using sterile phosphate-buffered saline (PBS; 137 mM NaCl, 8.10 mM Na2HPO4, 2.68 mM KCl, 1.47 mM KH2PO4) and left to dry for 15 min. For fixation, 200 µl of 100% methanol was added to each well for 30 min. After removing methanol, the adherent biofilms were stained with 200 µl of 0.1% crystal violet for 30 min. Then, the plates were washed at least 3 times with sterile PBS and air-dried for 15 min. Then, 100 µl of 99.9% ethanol was added to solubilize the stain, and then the absorbance values at 595 nm (A595) were measured using an absorbance microplate reader (Infinite F50 Plus, Tecan, Japan) (Chajęcka-Wierzchowska et al. 2016). Blank wells contained tryptone soya broth (TSB; Oxoid, Basingstoke, UK) without any bacteria.

Bacteriophages isolation and enrichment

Bacteriophages were isolated from 16 different samples including chicken feces, cow feces, compost, and raw milk collected from the Kyushu University farm, in Fukuoka, Japan. Briefly, 50 g of each sample was mixed with 100 µl of each E. faecalis isolate in a stomacher bag containing 100 ml of 2× TSB with 10 mM CaCl2 for 2 min and then incubated at 37 °C for 24 h. After that, 10 ml of the incubated suspensions were centrifuged at 12,000 ×g for 20 min at 4 °C, and the supernatant was filtrated using a 0.22 μm filter (Merck Millipore, Ireland) and used as a crude phage source. The detection of phages in the filtrated supernatant was done using the double-layer agar technique (Adams 1959). Briefly, 3ml of molten top agar (Oxoid) was inoculated with 100 µl of overnight bacterial culture and poured onto the surface of tryptone soya agar (TSA; Oxoid). Then, 15 µl of the phage suspension was spotted twice onto the multi-layer agar media, and plates were incubated at 37 ºC overnight. The following day, the plates were checked for the presence of lytic zones.

Purification and propagation of bacteriophages

Isolated bacteriophages were purified and propagated from a single plaque. Briefly, a single pure plaque was picked up using a sterile micropipette tip and suspended in a microcentrifuge tube containing 1 ml of saline magnesium (SM) buffer (0.05 M Tris-HCl buffer, 0.1 M NaCl, 8 mM MgSO4, and 0.01% gelatin, pH 7.5). Then, 100 µl of serially diluted SM buffer containing the resuspended plaque was mixed with 100 µl of the host culture, added to 4 ml top agar, and then poured onto TSA plates. Then, the plates were incubated overnight at 37 ºC. The isolation of phage from a single plaque was repeated at least 3 successive times until homogenous plaque morphology was obtained to produce a purified phage stock. After purification, bacteriophages were propagated to obtain high-titer phage stocks using the plate lysate method (Bonilla et al. 2016).

Host range and efficiency of plating (EOP) determination

The host range of our isolated phage was tested using the spot testing assay against 29 E. faecalis and 7 E. faecium hosts. Briefly, the top agar inoculated with 100 µl of the bacterial host was poured onto TSA solid plates and left to dry. Then, 10 µl of phage was spotted on the bacterial lawn and incubated at 37 ℃ for 24 h to check the lytic activity. The effectiveness of phage vB_EfKS5 against all sensitive E. faecalis host isolates was further assessed by the efficiency-of-plating method (EOP using the spot test assay as described before (Khan Mirzaei and Nilsson 2015). Briefly, the phage was serially diluted 10-fold in SM buffer. The top agar was inoculated with 100 µl of the fresh culture of each bacterium and poured onto the TSA plates, and 10 µl of each dilution was spotted in triplicates. The plates were incubated at 37℃ for 24 h to calculate the phage titer. EOP has been calculated as the ratio of the average PFU on target bacteria/average PFU on host bacteria.

Temperature and pH stability assays

Phage vB_EfKS5 stability was assessed at different temperatures (40, 50, 60, 70, 80, 90, and 100ºC) over 1 h using the method described by Hammerl et al. 2014). Phage vB_EfKS5 was incubated for 1 h in a water bath set at each temperature and 100 µl of the phage suspension was withdrawn at 10 min intervals, diluted, and immediately plated for phage titration. The stability of phage vB_EfKS5 at different pH values ​​was monitored (Park et al. 2017). The pH values of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, and 13 were prepared in PBS buffer and adjusted with 1 M HCl or 1 M NaOH solutions. Phage was incubated overnight at room temperature in each pH tube and the stability of the residual phage was assessed by plaque assay. Both temperature and pH experiments were conducted in triplicates.

Bacteriolytic activity and one-step growth analysis

The optimum Multiplicity Of Infection (MOI) of phage vB_EfKS5 was determined using the method described before (Li et al. 2021). The MOI is defined as the ratio of phage (PFU) titer to the number of the host bacteria (CFU). Briefly, 1 ml of phage vB_EfKS5 was mixed with an equal volume of the E. faecalis host at different MOIs (0.01–100), and the mixture was incubated at 37 °C for 3 h with shaking (160 rpm). After that, samples were withdrawn and centrifuged at 10,000 × g for 10 min. and the supernatant was serially diluted in SM buffer and spotted onto a double-layer agar plate aseptically to determine the phage titer. The MOI which gave the highest reduction in bacterial titer was considered the optimal MOI. The one-step growth curve of phage vB_EfKS5 was determined using the method described by Kropinski (2018). Briefly, E. faecalis isolate no.7 was grown to OD600 ~ 0.2 and infected with vB_EfKS5 phage at MOI of 0.1, and then the mixture was allowed to adsorb for 7 min at 37 °C. After adsorption, the mixture was centrifuged at 10,000 × g for 10 min. The supernatant was removed, and the pellet was resuspended in 10 ml sterile TSB and incubated at 37 °C for 90 min. Then, 200 µl was taken every 10 min, centrifuged, serially diluted in SM buffer, and immediately plated for phage titration. The experiment was repeated 3 times to calculate the latent period and burst size.

Bacteriolytic activity of phage against planktonic E. faecalis and its antibiofilm activity

The inactivation of E. faecalis planktonic cells and the antibiofilm activity with vB_EfKS5 phage was assessed in TSB broth in 96-well microtiter plates at different MOIs (Lerdsittikul et al. 2022). For the planktonic cells, the E. faecalis culture (1 × 108 CFU/ml) was mixed with phage suspension at different MOIs (0.001–1000) and the plates were incubated at 37 °C for 24 h and the growth of bacteria was estimated every 4 h by measuring absorbance at 595 nm.

The antibiofilm efficacy of phage vB_EfKS5 against E. faecalis was assessed using a 96-microtiter plate method as previously described (Sharma et al. 2021). Briefly, the plate wells were inoculated with the bacterial culture after dilution in TSB (OD600 ~ 0.2) and incubated at 37 °C for 24 h. The next day, the unattached cells were removed, and the wells were washed 3 times with PBS and dried in air. Subsequently, the phage vB_EfKS5 was added to the wells containing bacterial biofilm at different MOIs (0.01, 0.1, and 1) and incubated overnight at 37 °C. The supernatant was removed, and the wells were gently washed 3 times with PBS. Then, the plates were stained with 0.1% crystal violet solution for 20 min. After the removal of stains, wells were washed again with PBS. The ethanol (99.9%) was added to each well, and the absorbance was measured at A595 using an absorbance microplate reader.

Whole genome sequencing and bioinformatic analysis

The phage vB_EfKS5 genomic DNA was extracted from the purified high titer phage suspension (1011 PFU/ml) using the High Pure Viral Nucleic Acid Kit (Roche, Mannheim, Germany). The library preparation and whole-genome sequencing were carried out by Novogene (Japan). The whole genome was sequenced using an Illumina HiSeq system. The read sequences were assembled using DFAST v. 1.2.18 (Tanizawa et al. 2018). The assembled genome was annotated using the RAST server (Aziz et al. 2008), and further confirmation was done by BLAST analysis (Altschul et al. 1997). tRNA genes were identified using tRNAScan-SE v2.0 (Lowe and Eddy 1997). BLASTN and BLASTP programs were run to assign possible functions to the ORFs (Altschul et al. 1997). A phylogenetic tree of phage VB_EfKS5 with other related Enterococcus phages was created using Geneious v8.1.2 (https://www.geneious.com).

Determination of MIC and MBC of Nisin against E. faecalis

A fresh stock solution of nisin (106IU/g; Sigma, MO, USA) in 0.02 N HCl containing 0.75% NaCl was prepared and sterilized using a sterile 0.22-µm pore size membrane filter (Merck Millipore) before the experiment and then diluted two-fold (4000, 2000, 1000, 500, 250, 125, 62.5 U/ml) with sterile PBS. The overnight culture of E. faecalis JCM 7783 was adjusted to ~ 106 CFU/ml in TSB and the wells were inoculated with 100 µl of nisin and 80 µl of TSB. The bacterial suspension (20 µl) was added to each well and the control contained only 100 µl of water instead of nisin and 80 µl of TSB. The plates were incubated for 18–24 h at 37 °C. To determine the MBC, 10 µl of the corresponding inhibitory concentration was spotted aseptically on the agar plate in duplicates. After overnight incubation, the MBC was observed and defined as the lowest concentration that inhibited the visible growth of the subculture.

The combined effect of phage and nisin in broth

The efficiency of phage alone or in combination with nisin against planktonic E. faecalis in broth was assessed by the method previously described (Duc et al. 2020). Briefly, four groups were designed as follows:

Group A (Control): TSB (4700 µl) + E. faecalis (105 CFU, 100 µl) + PBS (200 µl).

Group B: TSB (4700 µl) + E. faecalis (100 µl) + phage (105 PFU, 100 µl) + PBS (100 µl).

Group C: TSB (4700 µl) + E. faecalis (100 µl) + nisin (500 U/ml, 100 µl) + PBS (100 µl).

Group D: TSB (4700 µl) + E. faecalis (100 µl) + phage (100 µl) + nisin (100 µl).

All mixtures were incubated at 37 °C for 24 h and 100 µl of each group was collected every 2 h, serially diluted, and spotted on TSA plates to enumerate the total viable count.

Synergistic antibacterial effect of phage and nisin in milk

The ability of vB_EfKS5 phage and nisin as well as the combination of both to inhibit the growth of E. faecalis in pasteurized milk was also estimated. Approximately 105 CFU/ml of E. faecalis was inoculated in 5 ml of milk and the phage was added at MOI of 1 with/without nisin (500 U/ml), and then the mixture was incubated at 37 °C for 24 h. The control group was treated only with sterile PBS without phage or nisin. The viable cells of the E. faecalis isolates were counted every 2 h as described above and are presented as CFU/ml.

Statistical analysis

All experiments were conducted three times. Data were analyzed statistically using GraphPad prism version 8.0.0 and were expressed as the mean ± standard deviation (SD) or percentage (%). The significance among the different groups was estimated using Student’s t-test. A p-value lower than 0.05 was considered significant.