Mice

MFG-E8−/− mice (C57BL/6 background), purchased from the Model Animal Research Center of Nanjing University, were mated from heterozygotes, and littermate MFG-E8+/+ mice were used as controls. Mice were housed in specific pathogen-free animal facilities at the Affiliated Drum Tower Hospital of Nanjing University Medical School. All animal experiments were performed in accordance with institutional guidelines and approved by the Animal Care Committee of Nanjing University.

Microglia and Astrocyte Culture

Primary microglia were obtained as previously described [16]. Briefly, C57BL/6J neonatal pups (P0–P1) were used. After removing meninges and visible blood vessels, the brains were digested with 0.25% trypsin in a 37 °C incubator for 10 min and then the same amount of Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum and 100 μg/mL streptomycin was used to terminate digestion. The cell suspension was seeded in 75 cm2 flasks and maintained at 37 ℃ in a humidified incubator with 5% CO2. The culture medium was changed every three days. After 10 days–12 days, loosely attached microglia were harvested from the medium by shaking the flasks for 10 min. After two microglia harvests, astrocytes were digested by trypsin and prepared for follow-up experiments.

OPC Culture

The OPCs were prepared from the cerebral cortices of newborn C57BL/6 pups. Briefly, after removing meninges, cortexes were dissected and then dissociated by mechanical trituration. Later, the suspension was filtered through a 70 μm nylon cell strainer and plated on plates coated with poly-D-lysine (Sigma, USA). The cells were cultured in a proliferation medium (DMEM/F12 containing B27, penicillin/streptomycin, 5 ng/mL basic fibroblast growth factor, and 15 ng/mL platelet-derived growth factor-AA). After 7 days–10 days, the medium was changed to a differentiation medium containing T3 (triiodothyronine, R&D systems, USA) and ciliary neurotrophic factor (GenScript) to induce the differentiation of OPCs. Conditioning medium from microglia was added into primary OPCs for further experiments.

Primary Neuron Culture

The primary neuron culture was prepared from E16 C57/BL6J mouse embryos as previously reported [17]. The cells were cultured in a Neurobasal medium with 1X B27 for 8 days–10 days. Then the mRNA of the neurons was extracted for the next experiments.

BCAS

C57BL/6 or MFG-E8 knockout mice weighing 25 g–28 g were used for BCAS surgery. The mice were anesthetized with 4% chloral hydrate (10 mL/kg) by intraperitoneal injection. The BCAS model was established as previously described [18]. Briefly, after exposing both common carotid arteries (CCAs) from their sheaths, a microcoil with a 0.18-mm inner diameter (Sawane Spring Co) was twined by rotating it around the right CCA. After 30 min, another micro-coil of the same size was twined around the left CCA.

Stereotaxic Intracranial Injection

A stereotaxic intracranial injection was performed following established protocols [19]. The injection site for the corpus callosum (CC) was determined based on the brain map, with coordinates of 1 mm lateral from the midline, 0.8 mm anterior from the bregma, and 2.2 mm deep from the bregma. To initiate the procedure, mice were anesthetized using 2.5% avertin. A small hole was drilled in the skull, and subsequently, 400 nL (200 nL per hemisphere) of MFG-E8-overexpressing AAVs (pAAV-CMV-Mfge8-3xFlag-P2A-mNeonGreen-tWPA, OBiO, China) or control AAVs (pAAV-CMV-3xFlag-P2A-mNeonGreen-tWPA, OBiO, China) were bilaterally injected into the CC. To prevent viral leakage, the micropipette was kept in place for 5 min after injection. Once the wound was sutured, the mice were allowed to regain consciousness on a thermostatic heat source.

Novel Object Recognition

The working memory was evaluated in each group of mice by using new object recognition (NOR). During habituation, the mice were allowed to explore an empty box. Three days after habituation, they were presented with two similar objects during the first session. Then one of the two objects was replaced by a new object during a second session. The time taken to explore the new object provided an index of recognition memory.

Open Field Test

The open field test (OFT) was used to measure general locomotor activity and anxiety-like behavior. Each mouse was gently placed into a corner of the open field box (40 cm × 40 cm × 40 cm) to explore freely for 10 min. The test sessions were recorded by a video camera installed on the ceiling above the apparatus. The total distance moved, mean velocity and corner time were recorded.

Fear Conditioning Test

The fear conditioning test was applied as described previously. The mice were placed in a conditioning chamber (Panlab, Spain) and allowed to freely explore it for 5 min. Then a 30-s tone (80 dB) was delivered followed by a 2-s foot shock (0.75 mA). After that, the mouse stayed in the chamber for another 1 min to evaluate post-shock freezing. Context-dependent memory was evaluated on the next day. The mice were again placed in the same chamber, but without any stimulation, and scored for the freezing behavior. The cue-dependent memory was examined in a novel chamber. The mice were placed in a novel chamber to freely explore for 1 min without any stimulation followed by 4-min tone-stimuli. Freezing was defined as a completely immobile posture except for respiration, and the freezing time was determined using Packwin software (Panlab, Spain).

MRI

Mice before and after BCAS surgery received an MRI scan on a 9.4T Bruker MR system (BioSpec 94/20 USR, Bruker) using a 440-mT/m gradient set, an 86-mm volume transit RF coil, and a single channel surface head coil. The mice were anesthetized by inhalation of 3% isoflurane before scanning. The T2-weighted imaging consisted of the following sequence: repetition time (TR) = 2500 ms, echo time (TE) = 33 ms, field of view (FOV)= 2 × 2 cm, matrix = 256 × 256, and slice thickness = 0.7 mm. diffusion tensor imaging was applied using the following spin-echo echo-planar imaging sequence: Two b-values (b = 0 and 1000 s/mm2) along with 30 non-collinear directions, δ = 4.1 ms, Δ = 10.3 ms; TR = 1500 ms, TE = 23.27 ms, FOV = 20 mm × 20 mm, matrix = 128 × 128, and 22 adjacent slices of 0.7 mm slice thickness. MRIcron was used to process the imaging data. Diffusion data were post-processed using the FSL (v.5.0.9) pipeline, consisting of corrections for eddy currents and movement artifacts (eddy_correct), rotations of gradient directions according to eddy current corrections (fdt_rotate_bvecs), brain mask extractions based on b0 images (bet), and fractional anisotropy (FA) map calculations by fitting a diffusion tensor model at each voxel (drift). CC areas were drawn using ITK-SNAP to extract the FA values. The heatmap was generated at the Institute of High Energy Physics, Chinese Academy of Sciences.

Electron Microscopy

Mice were subjected to transcardial perfusion with phosphate-buffered saline (PBS) and 4% phosphate-buffered paraformaldehyde (PFA). The CC samples were incubated overnight in 2.5% glutaraldehyde. Then the brains were postfixed in a mixture of 1% osmic acid and 1.5% potassium ferricyanide for 1 h at 4 ℃. After alcohol gradient dehydration, the samples were embedded in epoxy resin, and stained with uranyl acetate and lead citrate. Images were acquired using transmission electron microscopy (Hitachi, HT7800). The g-ratio was calculated by dividing the axonal diameter by the myelinated fiber diameter. Thirty myelinated axons were randomly analyzed across multiple fields per mouse to calculate the g-ratio.

Immunofluorescence Staining and Imaging

Mice were anesthetized and transcardially perfused with cold PBS and cold 4% PFA. The dissected brains were post-fixed in 4% PFA for 24 h at 4 ℃ and subsequently cryoprotected in 30% sucrose for 72 h at 4℃. Frozen sections were cut at 20 μm for use. Cells were fixed in 4% PFA for 30 min and washed three times with PBS. Sections or cells were blocked with 5% BSA and 0.25% Triton X-100 and incubated overnight at 4 ℃ with primary antibodies. The primary antibodies were as follows: Oligo2 (Millipore), CC1 (Abcam), PDGFRα38 (BD Biosciences), MFG-E8 (Santa Cruz), Iba-1 (Abcam), GFAP (Proteintech), Map2 (Bioworlde), CD68 (Abcam), and degraded myelin basic protein (dMBP; Millipore). The next day, sections or cells were incubated with appropriate secondary antibodies at room temperature for 2 h. Fluorescence images were obtained using a fluorescence microscope (Olympus IX73) or a confocal laser-scanning microscope (Olympus FV3000).

Black-Gold Staining

Black-gold staining was performed using the Black-Gold II myelin staining kit (Biosensis, USA). Briefly, 0.3% Black-Gold II solution was prepared and preheated to 65 ℃. Brain sections were incubated with Black-Gold II solution for 10 min at 65 ℃. During staining, the slides were monitored at 2 min–3 min intervals under the microscope to stain the finest myelinated fibers. After further washing in distilled water, the sections were fixed in 1% sodium thiosulfate for 3 min at 65 ℃. After 3 washes, the sections were dehydrated in a series of graded ethanols, cleared in xylene, and cover-slipped.

RT-PCR

Total RNA was extracted from fresh brain tissue using TRIzol (Invitrogen, USA) and was reverse-transcribed into cDNA using a PrimeScript RT reagent kit (Takara, China). Quantitative real-time PCR was performed on an ABI 7500 PCR instrument (Applied Biosystems) with a SYBR green kit (Takara, China). Relative gene expression was analyzed by 2−(ΔΔCt) with normalization to GAPDH. The primer sequences were as follows:

MFG-E8 Forward: AGATGCGGGTATCAGGTGTGA

MFG-E8 Reverse: GGGGCTCAGAACATCCGTG

GAPDH Forward: AGGTCGGTGTGAACGGATTTG

GAPDH Reverse: TGTAGACCATGTAGTTGAGGTCA

Western Blotting

Equal quantities of protein extracts were subjected to SDS-PAGE and transferred to polyvinylidene difluoride membranes (Millipore, USA). After blocking in 5% non-fat milk for 1 h at room temperature, the membranes were incubated overnight at 4°C with the following primary antibodies: MFG-E8 (Santa Cruze), NG2 (Millipore), and PLP1 (Abclone). The membranes were subsequently incubated with corresponding secondary antibodies and visualized with chemiluminescence reagents provided with an ECL kit (Bioworld, USA).

Myelin Debris Production

Mouse myelin was prepared as previously described [18]. Whole brains were removed from 6-week-old C57Bl/6 mice and myelin was isolated using a discontinuous sucrose gradient. Brains were isolated in 0.32 mol/L sucrose solution and cut into pieces. The homogenized brain solution was gently added to the surface of 0.83 mol/L sucrose solution. After centrifuging at 100,000 r/min for 45 min at 4 °C, the interface was collected and dissolved in 35 mL Tris.Cl buffer solution, and centrifuged at 100,000 r/min for 45 min at 4 °C. The supernatant was aspirated, and the pellet re-suspended in 10 mL–15 mL of Tris.Cl buffer and then centrifuged at 100,000 r/min for 45 min. The pellet was resuspended in 5 mL–6 mL of sterile PBS and centrifuged at 22,000 r/min for 10 min at 4 °C. Finally, pure myelin debris was achieved. The purified myelin pellet was sub-packaged at a concentration of 20 mg/mL with PBS and stored at − 80 °C.

Phagocytosis Assays

Wild-type primary microglia were plated in a 24-well plate at a density of 50,000 cells per well. The cells were incubated for 24 h at 37 °C under 5% CO2, and then recombinant murine MFG-E8 (200 ng/mL, R&D systems) and pHrodo-labeled myelin (100 μg/mL) were added to the medium at the same time. Then, primary microglia were digested by trypsin for flow cytometry.

Fluorescence-activated Cell Sorting (FACS) of Microglia and Astrocytes

Mice were anesthetized and transcardially perfused with ice-cold PBS. The brains were then dissected, removing the olfactory bulb, cerebellum, and brainstem. The remaining brain tissue was cut into small pieces, digested with trypsin for 8 min, and the resulting precipitate was collected. After resuspension with debris removal solution, Hanks’ balanced salt solution was slowly added, followed by centrifugation at 3,000 g at 4 °C. The top two layers, containing myelin sheath and liquid, were discarded, and the bottom layer was transferred. This layer was washed three times with PBS, and the cells were incubated with specific antibodies (GLAST-1-PE, CD11b-APC, and CD45-PE/C7) in the dark for 30 min. The cells were then resuspended for testing. Flow cytometry analysis and cell sorting were applied using a FACSAria II (BD Biosciences). The sorted cell populations were defined as follows: other cells (CD45- GLAST-1−), microglia (CD11b+CD45median), and astrocytes (GLAST-1+/CD45−). RNA isolation was carried out immediately after sorting using an RNA isolation kit. Post-sorting population analyses and graphical representations were generated using FlowJo software v.10 (TreeStar Inc.).

Statistical Analysis

GraphPad Prism software version 20.0 (GraphPad Software, La Jolla, CA) was used for statistical analysis. The data are expressed as the mean ± standard deviation (SD). For independent two-group comparison, the student’s t-test or the Mann–Whitney U test was applied, while for paired two groups, the paired t-test was used. For multiple comparisons, the data were analyzed by one-way analysis of variance (ANOVA) followed by Bonferroni’s post hoc test. P < 0.05 was considered statistically significant.