hPSC culture

hESCs (H9), iPSCs (W24B and W24M) and genetically modified cell lines derived from H9 were maintained on irradiated mouse embryonic fibroblasts (MEFs)51. Cells were cultured in the media containing DMEM/F12 basal medium (Thermo Fisher Scientific, 11330-032), 20% KnockOut Serum Replacement (Thermo Fisher Scientific, 10828028), 0.1 mM β-mercaptoethanol, 1 mM l-glutamine (Thermo Fisher Scientific, 25030081), non-essential amino acids (Thermo Fisher Scientific, 11140050) and 4 ng ml−1 FGF-2 (Wicell). The cells were passaged weekly by 1 mg ml−1 Dispase (Gibco, 17105-041).

NE neuron differentiation

Two to three days after hPSC passaging, the cells were cultured in the neural induction media consisting of DMEM/F12 (1:1), 1% N2 and 1× non-essential amino acids supplemented with BMP receptor inhibitor DMH1 (2 µM, Tocris, 4126), TGFβ receptor inhibitor SB431542 (2 µM, Stemgent, 04-0010-10) and WNT agonist CHIR99021 (1 μM, Tocris, 4953) (day 0 of NE differentiation) for 4 d. On day 4, the cells were lifted by gently blowing with a 1-ml pipette without digestion. Alternatively, the hPSCs were digested with 1 mg ml−1 Dispase for 30 s and cultured in the same media for one additional day in suspension. On day 5, the cultures were fed with the same media but without SB431542. On day 6, ACTIVIN A (25 ng ml−1, R&D Systems, 338-AC-050) was added to the culture for 3 d. On day 9, the neural spheres were plated on plates pre-coated with Matrigel and cultured in the neural differentiation media containing DMEM/F12/Neuralbasal (1:1), 1% N2, 2% B27 and 1× non-essential amino acids supplemented with 125 ng ml−1 (up to 200 ng ml−1) ACITIVIN A and 1 μM c-AMP for another 2–3 d. At around day 10–11, the cells were committed to the NE fate and ready to generate NE neurons.

For NE neuron differentiation, on day 10–11, the cultures were digested into small clusters or single cells by Accutase and cultured in the neural maturation media consisting of neurobasal, 1× B27, 1× non-essential amino acids, 1% GlutaMAX (Gibco, 35050-079) supplemented with 1 μM c-AMP (Sigma-Aldrich, D0627), 0.2 mM ascorbic acid (Tocris, 4055), 10 ng ml−1 glial-cell-line-derived neurotrophic factor (GDNF) (PeproTech, 450-10), 10 ng ml−1 brain-derived neurotrophic factor (BDNF) (PeproTech, 450-02) and 1 ng ml−1 TGFβ1 (PeproTech, 100-21C). Alternatively, NE neuron differentiation was done by changing the culture medium to the neural maturation media without digestion and replating.

Animals

All animal experiments were conducted according to a protocol approved by the animal care and use committee at the University of Wisconsin-Madison. Adult SCID mice (8–12 weeks) were housed in a pathogen-free environment with a 12-h on and 12-h off day/night cycle, temperature around 24 °C and humidity between 40% and 60%. All animals had access to food and water freely. Cell transplantation was performed as previously described52.

snRNA-seq

The differentiating cells were harvested at indicated timepoints and disassociated by TrypLE (Thermo Fisher Scientific). All cells were collected as pellets by centrifuge after digestion. Samples then underwent nucleus isolation and library construction procedures as described below:

Nucleus isolation: prepare the Lysis Dilution Buffer (10 mM Tris-HCl (pH 7.4; Sigma-Aldrich, T2194), 10 mM NaCl (Sigma-Aldrich, 59222C), 3 mM MgCl2 (Sigma-Aldrich, M1028), 1% BSA (Miltenyi Biotec, 130-091-376), 1 mM DTT (Sigma-Aldrich, 646563) and 1 U µl−1 RNase inhibitor (Sigma-Aldrich, 3335402001) in nuclease-free water (AmericanBio, AB02123-0500)). Then, 500 µl of chilled 0.1× Lysis Buffer (1× Lysis Buffer: Lysis Dilution Buffer with 0.1% Tween-20 (Bio-Rad, 1662404), 0.1% Nonidet P40 Substitute (Sigma-Aldrich, 74385) and 0.01% digitonin (Thermo Fisher Scientific, BN2006)) was added to the samples to suspend the pellets. The suspension was homogenized in an autoclaved ice-cold 1-ml dounce tissue grinder (DWK Life Sciences, 357538) (30 times with a loose pestle and 30 times with a tight pestle). After a 5-min incubation on ice, the sample was gently pipetted 15 times, followed by a 10-min incubation on ice in 500 µl of Wash Buffer (Lysis Dilution Buffer with 0.1% Tween-20). The solution was filtered through 70-µm (Corning, 352350) and 40-µm (Corning, 352340) tube top cell strainers sequentially (both strainers were pre-wetted with 250 µl of Wash Buffer). The filtered homogenate was then transferred to a 15-ml tube and centrifuged at 500g for 5 min at 4 °C using a swing-out rotor (Eppendorf, 5943000343). The pellet was resuspended in 1 ml of Wash Buffer and centrifuged at 500g for 5 min at 4 °C. Count the cell number to determine the final resuspension volume after repeating the washing once. The nucleuses were centrifuged at 500g for 5 min at 4 °C and then resuspended in the volume calculated in the previous step using Diluted Nuclei Buffer (10x Genomics, 2000153) with 1 mM DTT, RNase inhibitor 1 U µl−1 and nuclease-free water. Then, 10 µl of sample was loaded onto a hemocytometer and counted to determine the final concentration.

Library construction: only samples that had a minimum concentration of 3.23 million nuclei per milliliter were used for generation of snRNA-seq libraries using Chromium Next GEM Single Cell Multiome Reagent Kit A (10x Genomics, PN-1000282) following the instructions of the ‘Chromium Next GEM Single Cell Multiome Reagent Kits User Guide’. For snRNA-seq libraries, after pre-amplification, cDNA was constructed, and sample-indexed libraries were generated using Library Construction Kit (10x Genomics, PN-1000190) and Dual Index Kit TT Set A (10x Genomics, PN-1000215) following the manufacturer’s protocol.

snRNA-seq data analysis

Alignment of raw sequencing reads and generation of feature barcode matrices were done by Cell Ranger (7.1.0). Seurat (4.1.3) was used to process the feature barcode matrices and analyze the snRNA-seq data32. All samples were processed under standard quality control. Single cells with more than 600 unique genes (nFeature) and less than 5% mitochondrial gene reads (percent.mt) were selected for follow-up analysis. Additional procedures were used to exclude low-quality cells and doublets in each sample. For day 6 sample, nCount_RNA is set to >4,500, and the total unique gene number is set to <6,000. For day 14 sample, nCount_RNA is set to >2,200, and the unique gene number is set between 1,500 and 5,500. In this study, a total of 8,732 high-quality cells were included in the analysis. After quality control, all the snRNA-seq data were normalized using the SCTransform function in Seurat with the mitochondria genes regressed out. Principal component analysis (PCA), UMAP reduction and gene feature plots were done by using Seurat as well. Trajectory analyses were done by using Monocle3 with the Seurat object53. Mapping the snRNA-seq transcriptomic profile to the Allen Developing Mouse Brain ISH Atlas was done by using VoxHunt34. All NE neuron clusters at day 14 samples were mapped to the E10.5 mouse embryo ISH atlas (https://developingmouse.brain-map.org/).

Genome editing

We knocked the Cre recombinase into the TH locus C-terminus and the GrabNE1m into the AAVS1 site by CRSIPR–Cas9 following the published method54,55. The sgRNA used for AAVS1 site was from Addgene (plasmid 41818)56. The sgRNA (TAGGTGCACGGCGTCCCTGA) for the C-terminus of the TH locus was designed according to Benchling (https://www.benchling.com/). The donor plasmid for the TH reporter was generated by NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs, E2621S). In brief, hPSCs were digested by TrypLE Express. We used Gene Pulser Xcell (Bio-Rad) for CRISPR–Cas9 delivery. Two million cells were electroporated with 15 μg of sgRNA plasmid and 30 μg of donor plasmid. Cells were plated at ∼150,000 cells per well of a six-well plate. Starting from 24 h after electroporation, 0.5 μg ml−1 puromycin was added to the culture medium. After 3 d of puromycin selection, hPSCs were switched to their normal culture medium and fed every other day until 1–2 weeks after electroporation when distinct colonies were established. Individual colonies were selected and transferred to 24-well plates (one clone to one well). Then, 3–5 d later, 1–2 clones from each well were picked up to collect the genome DNA for genotyping and DNA sequencing.

Cell transplantation

All animal experiments were conducted according to a protocol approved by the animal care and use committee at the University of Wisconsin-Madison. In brief, small aggregates of NE neural progenitors (day 10–12) were collected and suspended in artificial cerebral spinal fluid (aCSF) containing Rock inhibitor (0.5 μM), at a concentration of 100,000 cells per microliter. Then, 1 μl of cells was slowly injected into the left cortex (AP = +0.0 mm, ML = +1.8 mm, DV = −1.7 mm, from skull) of adult SCID mice (8–12 weeks) that were anesthetized with 1–2% isoflurane mixed in oxygen. The animals were killed 3 months after transplant for histological analysis, as described52.

Immunocytochemistry and flow cytometry

Immunocytochemistry was performed as described previously57,58. In brief, cells on coverslips were fixed in 4% neutral-buffered paraformaldehyde (PFA) for 10 min at room temperature. After rinsing with PBS, they were incubated in 0.2% Triton X-100 (in PBS) for 10 min, followed by 10% donkey serum (in PBS) at room temperature for 1 h. They were then incubated with primary antibodies diluted in 5% donkey serum in 0.1% Triton X-100 (in PBS) at 4 °C overnight, followed by fluorescently conjugated secondary antibodies at room temperature for 30 min. The nuclei were stained with Hoechst. Images were collected with a Nikon A1 laser-scanning confocal microscope.

Flow cytometry was performed using Transcription Factor Buffer Set, which is designed for transcription factor staining, following the manufacturer’s instructions. In brief, single cells were prepared using TrypLE Express Enzyme and fixed in the fixation buffer provided in the kit at 2–8 °C for 45 min. After three washings with the permeable buffer, the primary antibodies were added to cells for 45 min at 2–8 °C in a light-tight box. The cells were washed three times before incubation with fluorescently conjugated secondary antibodies for 45 min at 2–8 °C in a light-tight box. After three times of washing, cells were suspended in washing buffer and analyzed by flow cytometry (BD LSR or BD LSRII). Data analysis was performed using FlowJo (version 10) software.

Primary antibodies used in this study were: OTX2 (1:1,000, AF1979, R&D Systems), EN1 (1:500, 4G11, DSHB), HOAX2 (1:1,000, H9665, Sigma-Aldrich), SOX1 (1:1,000, AF3369, R&D Systems), PAX3/7 (1:200, sc-365843, Santa Cruz Biotechnology), PAX6 (1:1,000, PRB-278P, BioLegend), SOX2 (1:1,000, AF2018, R&D Systems), PHOX2B (1:2,000, AF4940, R&D Systems) or (1:1,000, 66254, Proteintech), ASCL1 (1:500, 556604, BD Biosciences), PHOX2A (1:50, sc-81978, Santa Cruz Biotechnology) or (1:100, ab155084, Abcam), TH (1:1,000, P40101, Pel-Freez Biologicals) and DBH (1:5,000, 22806, Immunostar), neurofilament marker (SMI312) (1:500, 837904, BioLegend), CRHR1 (1:100, 20967-1-AP, Proteintech), orexin receptor 1 (1:500, 18370-1-AP, Proteintech), COMT (1:200, sc-137253, Santa Cruz Biotechnology), NPY (1:1,000, ab30914, Abcam), MOR (1:5,000, 24216, ImmunoStar), ADRA2A (1:100, SAB4500548, MilliporeSigma), PNMT (1:100, AB110, MilliporeSigma), GALANIN (1:500, HPA049864, Sigma-Aldrich), NET (1:1,000, ab211463, Abcam), VGLUT1 (1:500, Synaptic Systems, 135 303), peripherin (1:200, sc-377093, Santa Cruz Biotechnology), CaMKII (1:200, sc-5306, Santa Cruz Biotechnology) and MAO (1:200, sc-271123, Santa Cruz Biotechnology).

Secondary antibodies used in this study were: Alexa Fluor 488 donkey anti-goat IgG (H+L) (1:1,000, A11055, Molecular Probes), Alexa Fluor 546 donkey anti-mouse IgG (1:1,000, A10036, Molecular Probes), Alexa Fluor 488 donkey anti-mouse IgG (H+L) (1:1,000, A21202, Molecular Probes), Alexa Fluor 488, donkey anti-rabbit IgG (H+L) (1:1,000, A21206, Molecular Probes), Alexa Fluor 594 goat anti-rabbit IgG (H+L) (1:1,000, A11037, Molecular Probes) and Alexa Fluor 546 donkey anti-rabbit IgG (H+L) (1:1,000, A10040, Life Technologies).

ELISA

To detect neurotransmitter release into the media during neuronal differentiation, we collected supernatant at indicated timepoints along differentiation. The cells were treated with drugs (maprotiline 25 µM (Tocris, 0935), tomoxetine 10 µM (Tocris, 2011), nisoxetine 10 µM (Tocris, 1025) and reboxetine 10 µM (Tocris, 1982)) for 4 h or KCl (40 mM) for 30 min before collecting the medium. ELISA was performed by using the Dopamine & Noradrenaline Sensitive ELISA Assay Kit (Eagle Biosciences, BCU39-K02) following the manufacturerʼs instructions.

Electrophysiology

Whole-cell patch-clamp recordings were done from hESC-derived NE neurons at 4 weeks. In brief, the neurons were held at −70 mV to record the Na+/K+ channel activities with the voltage-clamp model. For recording action potentials, the cells were held at 0 pA with the current-clamp model and with the steps of injected currents from −50 pA to +50 pA. The bath solution consisted of 135 mM NaCl, 3 mM KCl, 2 mM CaCl2, 1 mM MgCl2, 10 mM HEPES, 11 mM glucose, 10 mM sucrose, pH 7.4. Hypercapnia condition was produced by bubbling the bath solution with 5% CO2 (balanced with oxygen). Recording pipettes were filled with an intracellular solution containing 120 mM potassium d-gluconate, 1 mM ethylene glycol-bis (β-aminoethylether) N,N,N′,N′-tetraacetic acid (EGTA), 10 mM 4-(2-hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES), 4 mM ATP-Mg, 0.3 mM GTP-Na, 10 mM phosphocreatine, 0.1 mM CaCl2, 1 mM MgCl2, pH 7.2, 280–290 mOsm L−1. An Olympus BX51WI microscope was used to visualize neurons. A MultiClamp 700B amplifer (Axon Instruments, Molecular Devices) was used to investigate the voltage-clamp and current-clamp recordings. Signals were filtered at 4 kHZ using a Digidata 1550B analog/digital converter (Axon Instruments) and stored for further analysis. Data were analyzed with Clampfit 11.0.3 (Axon Instruments), GraphPad Prism 5 (GraphPad Software), CorelDraw 2019 (Corel) and Igor 4.0 (WaveMetrics). Drugs such as clonidine (1 mM) and the cocktail blocker solution containing antagonists for NMDA receptor (50 µM D-AP5, Sigma-Aldrich, A8054), non-NMDA glutamate receptors (20 µM CNQX, Sigma-Aldrich, C239), GABA receptor (20 µM bicuculline, Sigma-Aldrich, 14340) and glycine receptor (10 µM strychnine, Sigma-Aldrich, S8753) were used to treat the cells to examine their effects on NE neuron firing.

Calcium imaging and analysis

Neuronal Ca2+ imaging, image processing and data analysis were performed as described previously with modifications59. In brief, cells were bulk-loaded with Fluo-4/AM for 15 min at 37 °C in aCSF containing Fluo-4/AM (12.5 μg ml−1), pluronic acid (0.05%) and DMSO (0.1%). Then, cells were transferred to a chamber, and Ca2+ imaging was performed with a Nikon A1 confocal microscope at room temperature. All image data were taken in the frame-scanning mode at four frames per second. The Ca2+ imaging data were analyzed using Python. Ca2+ signals were presented as relative fluorescence changes (ΔF/F0) from specified regions of interest (ROIs). In this experiment, only mCherry+ cells were selected for analysis. For the traces with baseline drift, baseline correction was performed using a rolling ball algorithm. The peaks were detected using the algorithm developed by MATLAB (findpeaks function). The frequency and amplitude were calculated and measured. Images with obvious motion were excluded for analysis. In experiments that examined spontaneous Ca2+ oscillations, the Ca2+ level was reported as ΔF/F0 = (Ft − F0) / F0. Calcium elevation events were detected with thresholds of three times of s.d. of the baseline.

Fluorescence imaging of GRABNE1m sensor cells

The neurons were plated following the NE differentiation protocol and cultured on a 35-mm glass-bottom dish (well size 14 mm, #1.5 glass-like polymer coverslip (D35-14-1.5P, Cellvis)) until day 30 for maturation. Expression GRABNE1m in hPSC-derived NE neurons was imaged live under the Nikon A1 confocal microscope. The cells were allowed to condition at room temperature after changed to the electrophysiological buffer consisting of 135 mM NaCl, 3 mM KCl, 2 mM CaCl2, 1 mM MgCl2, 10 mM HEPES, 11 mM glucose, 10 mM sucrose, pH 7.4. Then, the cells were recorded for 6–7 min under ×20 objective with PFS on to monitor the dynamic fluorescence intensity change before treatments with neurotransmitters (NE, DA, 5-HT or control solution) or drugs (DA, 5-HT and NRIs) at indicated concentration. The extracellular NE level changes were quantified by ΔF/F0 = (Ft − F0) / F0 using ImageJ (1.53q).

Statistics and reproducibility

Statistical analyses were performed using GraphPad Prism 5 or Microsoft Excel software. The methods used to assess the significance are specified in the figure legends. The exact statistical values are provided in figures and the source data used for plotting in the respective figures. Representative data, such as qPCR and immunostaining shown in all the figures, were repeated at least three times independently with similar results.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.