Subjects

Ten male and 10 female 4-week-old, and 34 male and 26 female 8- to 9-week-old Sprague Dawley rats were used. All animals were obtained from Envigo (Fredrick, MA) and upon arrival were housed two per cage with free access to water and rat chow. Male and female rats were housed in the same room using ventilated racks and, in all cases, males and females were ran simultaneously for behavioral and molecular assays. Likewise, all male and female subjects were shipped at the same age and arrived on the same date. For experiments using 4-week-old and 9-week-old animals, rats were shipped at either 3 weeks or 8 weeks of age, respectively, allowed 48 hours to recover from shipping, then handled four consecutive days before being euthanized on the seventh day post-arrival. Animals were maintained under a 12:12-h light/dark cycle, with experiments and animal handling taking place only during the light portion of the cycle. All animals were handled for 4 days prior to behavioral experiments or euthanasia. Animals within a cage were randomly assigned to experimental groups and while researchers were not blinded to group allocation, they were unable to distinguish between animals during the behavioral procedures. All procedures were approved by the Virginia Polytechnic Institute and State University Institutional Animal Care and Use Committee (protocols #20-233) and conducted with the ethical guidelines of the National Institutes of Health.

Plasmid cloning

The CMV-dPspCas13b-GS-ADAR2DD(E488Q/T375G)-delta-984-1090 (Addgene #103871) plasmid was used. The K48 guide RNA (gRNA) plasmid was generated using the pC0043-PspCas13b crRNA backbone (Addgene #103854) plasmid and validated in our prior study, where detailed methods and gRNA information can be found [20].

Cranial infusion of plasmids

CRISPR plasmids were infused into the BLA as previously described [18, 20]. During surgery, animals were anesthetized with 1.5–4% isoflurane in 100% O2. Plasmids were bilaterally infused into the BLA using In Vivo Jet-PEI (Polyplus, Berkley, CA) as a transfection reagent, as previously described [18, 20]. Infusion of plasmids was done with a linear actuator set at a constant rate of 0.1 µl per minute for a total volume of 0.5 µl per side with the following coordinates related to bregma: AP -3.0 mm, ML ± 5.0 mm, DV -7.7 mm. Following surgery, animals recovered for at least 14 days before being handled. Behavioral procedures did not take place until 28 days after surgery.

Behavioral apparatus

The two identical Habitest chambers used for contextual fear conditioning have been previously described by our group [19, 20]. Briefly, each chamber comprises a steel test cage with front and back Plexiglass walls, a grid shock floor, and plastic drop pan. In the top back corner of the chamber is a house light, which remained on during behavioral procedures. Each chamber sits within an isolation cubicle that contains an acoustic liner and a house fan, which remained active during behavioral procedures Behavior was recorded and stored for later analysis using a USB camera mounted at a 45° angle outside of the back Plexiglass wall of the chamber. A precision animal shocker under the control of FreezeFrame 4 software was used to deliver a shock through the grid floor during training. FreezeFrame 4 software was also used to analyze animal behavior in real-time, using a freezing threshold of 2.0. The chamber walls were wiped with 70% isopropanol before use and between animals.

Behavioral procedures

Behavioral procedures have been previously outlined [20]. Briefly, animals were handled 4 days prior to contextual fear conditioning. During the training session, animals were placed into the fear conditioning apparatus, given a 1 min baseline, and then received 4 unsignaled footshock (1.0 mA, 1 s, 59 s ITI) presentations, followed by a 1 min post-shock period. Animals were then placed back into their homecages. One day later, animals were placed back into the fear conditioning apparatus for 5 min, during which time no footshock presentations were given, and then returned to their homecage.

Tissue collection

Rats were placed in a necrosis chamber and overdosed on isoflurane. Animals were decapitated and the brain was immediately removed and frozen on dry ice. Animals for baseline experiments were euthanized in the morning hours. Animals that underwent training were euthanized one day after the testing session. Both hemispheres of the BLA and the CA1 region of the hippocampus were then dissected out by blocking the brain in a rat brain matrix (Harvard Apparatus, Holliston, MA) incubated with dry ice. All dissected tissue was frozen at -80 °C until needed.

Whole cell protein extraction

BLA and CA1 tissue was homogenized in whole cell lysis buffer as previously described [19]. Briefly, one hemisphere of tissue was homogenized in 500 µl buffer and then transferred to a microcentrifuge tube stored on ice. Homogenates were centrifuged at 10,000 × g for 10 min at 4 °C, the supernatant was collected, and then the Bio-Rad DC protein assay was used to measure protein concentration.

Tandem ubiquitin binding entity

Tandem ubiquitin binding entity (TUBE) for K48 purification was conducted using previously described procedures [19]. Briefly, the high affinity K48-specific TUBE (#UM407M, Life Sensors, Malvern, PA) was washed in wash buffer before whole cell BLA protein samples were added. The bead/protein mix was incubated on an end-over-end rotator for 2 h at 4 °C. Samples were washed, collected by incubating at 96 °C for 5 min at 800 rpm in 1X sample buffer (Bio-rad, Hercules, CA), and then cooled to room temperature. Supernatant was stored at − 80 °C for mass spectrometry or western blot.

Liquid chromatography/mass spectrometry

Liquid chromatography mass spectrometry (LC/MS) was competed using our previously described detailed methods [19]. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE [1] partner repository with the dataset identifier PXD042021 and 10.6019/PXD042021.

DNA isolation

DNA was isolated from BLA tissue using the Qiagen Allprep kit (Germantown, MD) following manufacturer’s instruction. DNA concentration was measured on the Take3 (BioTek, Winooski, VT), normalized (50 ng), and used for direct bisulfite sequencing.

Direct bisulfite sequencing

Direct bisulfite sequencing of the Uba52 promoter using previously described methods [18]. Briefly, genomic DNA (50 ng) was bisulfite converted using the Qiagen Bisulfite Kit before the Uba52 promoter was amplified with a semi-nested PCR protocol. HotStarTaq Master Mix (#203443, Qiagen) was used for PCR procedures. The following methyl-specific primers for were used: Uba52 F1: TAAATAAAAATTATGTTTGAAAGGTAATAT; Uba52 F2: AATAAAAATT.

ATGTTTGAAAGGTAATATAG; Uba52 R: AAAAAAAACCAAACTATCTAAAACC. PCR products from the second PCR were purified using ExoSAP-IT (Affymetrix, Santa Clara, CA) and then sequenced with the reverse primers by the Genomics Sequencing Center at the Fralin Life Sciences Institute of Virginia Tech. Percent methylation of the CpG sites was determined by the ratio between peak values of guanine (G) and cytosine (C) measured using Chromas software, C/(C + T) * 100. Sample size was chosen for a large effect size based on prior work using similar methods [18, 34, 35].

Western blot

Western blot was conducted using previously outlined procedures [19]. Briefly, normalized whole cell protein samples (10 µg) were ran through SDS-PAGE using 7% Acrylamide gels and then transferred onto a membrane using a Turbo Transfer System (Biorad). Membranes were incubated for 1 h at room temperature in a 50:50 blocking buffer (50% Licor TBS blocking buffer and 50% TBS + 0.1% Tween-20) and then incubated overnight at 4 °C in primary antibody in 50:50 blocking buffer. The next morning, membranes were washed with TBS + 0.1% Tween-20 (TBSt) and incubated for 45 min at room temperature in secondary antibody (1:40,000; goat anti-rabbit 700CW) in 50:50 blocking buffer. Membranes were then washed twice with TBSt and then rinsed with TBS before being imaged using the Odyssey Fc (LI-COR, Lincoln, NE). Image Studio Ver 5.2. was used to analyze visualized proteins. Membranes were stripped with 0.2 M NaOH followed by two TBSt washes to remove the primary antibody and then incubated for 1 h at room temperature in blocking buffer. Samples were normalized to β-actin, which was used as a loading control. OD levels were normalized to 4-week-old male rats in experiments with 4-week-old and 9-week-old animals or to 9-week-old male rats in experiments with only 9-week-old animals due to variability between gels requiring normalization [18, 36].

Antibodies

Antibodies used for western blotting included K48 polyubiquitin (1:1000; #ab140601, Abcam, Cambridge, MA) and β-actin (1:1000; #4967, Cell Signaling, Danvers, MA).

Statistical analysis

All data are presented as mean with standard error, with individual sample values included in bar graphs (not in line graphs). All group sizes, number of replications, and statistical tests are reported in the figure legends. Outliers were defined as data points falling two or more standard deviations from the group mean. One outlier was removed from 4-week-old female amygdala K48 polyubiquitination level western blot data and 4-week-old and 9-week-old female hippocampus K48 polyubiquitination level western blot data. Prism software (GraphPadSoftware, La Jolla, CA) was used to assess normality and analyze data. Training data were analyzed using three-way analysis of variance (AVOVA). All other data were analyzed using two-way ANOVA and Tukey’s honest significant difference post hoc test or two-tailed t-tests as indicated in figure legends. Nonparametric data were analyzed with Mann–Whitney U test.

LC/MS data were analyzed in a similar manner to previously described methods [37]. Data were first log transformed (Log2(x + 1)) and proteins identified as having more than 15 zero values were excluded from analysis. The transformed data were analyzed using a generalized mixed model (two-way ANOVA with Tukey’s honest significant difference post hoc test) with the R package ‘lme4’ to compare Age, Sex and an interaction between Age X Sex, with subject as a random effect. Two-tailed t-tests were also conducted in R to identify differences between the ages within each sex. Samples were run in duplicates and the mean of individual replicates were plotted in scatterplot graphs with mean per group and standard error bars also depicted for each significant protein. In all analyses, the p-values were adjusted using false discovery rate (FDR), with significance being defined as FDR < 0.05. Log2(Fold Change) was calculated separately using LC/MS data by adding 1 to every value (Protein Abundance + 1), taking the average of the groups and then dividing the appropriate groups for each comparison followed by log2 transformation of the resulting values. All LC/MS statistical data and fold change values can be found in Additional file 2.