Abstract

Introduction: Metformin is one current medicine used to treat type 2 diabetes. Numerous studies have shown that high metformin concentrations have an anti-cancer effect. Therefore, this study aimed to examine whether combining various metformin and glucose concentrations affects mouse breast cancer cell proliferation, migration, and expression of immune escape-related genes.

Methods: This study assessed 12 glucose and metformin combinations: four glucose concentrations (0, 0.5, 1.0, and 4.5 g/L) and three metformin concentrations (0, 2.0, and 5.0 mM). Mouse breast cancer 4T1 cells were cultured in RPMI 1640 media containing these 12 combinations at 37?C with 5% CO2. The combinatorial effects of metformin and glucose were evaluated based on 4T1 cell proliferation, migration, and expression of immune escape-related genes.

Results: Combining 2 mM metformin with 4.5 g/L glucose concentration inhibited 4T1 cell proliferation, migration, and expression of immune escape-related genes.

Conclusion: Our findings provide more information about the anticancer effects of metformin under high glucose conditions, help explain why metformin effectively treats cancer in patients with type 2 diabetes, and suggest combining metformin with glucose in anticancer treatment.

Introduction

Patients with type 2 diabetes are known to be at a higher risk of tumorigenesis1. Therefore, researchers have suggested that glucose levels could affect tumor growth. Glucose is considered an important fuel source because it provides energy to cells in the form of ATP and produces intermediate products, such as lactate, for cell survival and growth2. Cancer cell populations have been demonstrated to utilize high glucose levels for proliferation. Glucose participates in many metabolic pathways within cells. Unlike normal cells, cancer cells can reprogram their metabolism, extracting energy from glucose via glycolysis (Warburg effect). Therefore, these reprogramming mechanisms promote cancer cell proliferation, migration, and especially immune escape, making them challenging to kill3, 4, 5. Furthermore, immune cells use this metabolism to grow and proliferate. However, immune cells compete with cancer cells for glucose sources in the tumor environment. Therefore, immune cell proliferation and survival are impeded, making it more challenging to eradicate cancer cell populations.

The immune system is responsible for protecting the body from harmful agents. Notably, cancer cells interact closely with the immune system. One key step influencing immune escape is blocking the interaction between cancer and immune cells. As is typical of the interaction between programmed death-ligand 1 (PD-L1) on cancer cells and programmed cell death 1 (PD-1) on immune cells, once PD-L1 is overexpressed, a PD-1/PD-L1 complex forms, causing a signaling cascade that inhibits immune cells6. In addition, the metabolism of the immune cells is impacted by the nutritionally uneven tumor microenvironment. Glycolysis dominates in the tumor microenvironment, having multiple effects on immune cell populations, such as decreased activity of CD4 and CD8 T cells and capacity of memory T cells through several intracellular signaling pathways such as the AMP-activated protein kinase (AMPK)/protein kinase B (AKT)/mechanistic target of rapamycin (mTOR) pathway7. The tumor microenvironment also impacts tumor-associated macrophages. It promotes cancer cell survival and growth, which are stimulated to form the M1 phenotype when the glycolysis pathway dominates. Numerous studies on glucose metabolism have been initiated due to these drugs to ensure efficient cancer treatment. Metformin is one drug utilized in current basic research and clinical studies.

The drug metformin acts on the glucose metabolism pathway and is effective in treating type 2 diabetes. Recent studies have demonstrated its impact on the effectiveness of cancer treatment. It was more effective in treating patients with type 2 diabetes and cancer than those with type 2 diabetes alone8, 9. One of the numerous ways metformin impacts cancer cells is through their relationship with the immune system, which is one process through which they avoid being eliminated by the immune system, called immune escape10, 11. In order to eliminate “foreign” cells in this area, cancer cells produce enzymes and cytokines through surface markers, immune checkpoints, and immune cells. Metformin acts on cell signals, causing changes in the expression of these immune markers, which help in the effective recognition of cancer cells by immune cells12. PD-L1 is one well-known checkpoint in cancer cells. Metformin was found to interact favorably with PD-L1, influence PD-L1 expression, and be a potent anti-PD-L1 agent that limits the immune-escape ability of cancer cells by enhancing the activity of immune cells such as T cells13. Cancer killing may affect other cell populations at different metformin concentrations, such as mesenchymal stem cells (MSCs)14.

Therefore, we wondered whether high glucose levels impact the cancer population through metformin. Combining an appropriate metformin concentration with a suitable glucose concentration could inhibit immune escape and protect beneficial cell populations. This study aimed to investigate the combinatorial effects of metformin and glucose on mouse breast cancer 4T1 cell proliferation, migration, and expression of immune escape-related genes.

Materials and methods Cell line

The mouse 4T1 cell line (American Type Culture Collection) was thawed and expanded according to the provided guidelines. It was maintained at 37°C in a humidified atmosphere (95%) containing 5% CO2. It was cultured in growth medium (Roswell Park Memorial Institute [RPMI] 1640 containing 2 mmol/L glutamine [Sigma-Aldrich, Louis St, MO, USA], 10% fetal bovine serum [FBS; Gibco], 1% antibiotic-antimycotic [Sigma-Aldrich]).

Experimental designs

The RMPI 1640 medium was supplemented with four glucose concentrations (0, 0.5, 1.0, and 4.5 g/L) and three metformin concentrations (0, 2, and 5 mM). Therefore, this study examined 12 glucose and metformin combinations (G1 to G12; Table 1).

Table 1.

The examined glucose and metformin combinations

Groups G1 G2 G3 G4 G5 G6 G7 G8 G9 G10 G11 G12 Glucose (g/L) 0 0 0 0.5 0.5 0.5 1 1 1 4.5 4.5 4.5 Metformin (mM) 0 2 5 0 2 5 0 2 5 0 2 5

The 4T1 cells were expanded in the standard growth medium and then split into six-well plates at 5,000 cells/well. After 24 h of culturing, the standard growth medium was replaced with the G1–G12 media. The cells were collected for further experiments after 24, 48, and 72 h of culturing in the G1–G12 media. Each medium was used in three wells, and the experiments were performed in triplicate.

Cell viability

The Alamar blue assay was used to assess cell proliferation. The cells were seeded at a density of 5,000 cells/well in 96-well plates. After 24 hours of culturing, the growth medium was discarded and replaced with G1–G12 media. Then, the cells were stained with Alamar blue (Sigma-Aldrich) at a dye:medium ratio of 1:10. After one hour of staining at 37°C with 5% CO2, each well’s optical density at 595 nm was determined using a DTX880 multimode detector (Beckman Coulter, USA). Data was collected every 24 hours. Triplicates were performed for each group.

Quantitative real-time PCR (qRT-PCR)

The qRT-PCR was performed according to a general protocol. RNA was extracted using the EasyBlue Kit (Thermo Fisher Scientific, USA), and cDNA was synthesized via reverse transcription. The relative mRNA levels were determined using a Luna One-Step RT-qPCR Kit (New England Biolabs). Gene expression was calculated using the 2−ΔΔCt method. Glyceraldehyde-3-phosphate dehydrogenase (Gapdh) was used as the endogenous control. The experiment was performed in triplicate. The following primers were used to amplify the target genes by RT-qPCR: Gapdh forward (GCATCTTCTTGTGCAGTGCC) and reverse (TACGGCCAAATCCGTTCACA), solute carrier family 2 (facilitated glucose transporter), member 1 (Slc2a1/Glut1) forward (ATCGTCGTTGGCATCCTTATT) and reverse (ATCGTCGTTGGCATCCTTATT), Pd-l1 forward (TCCATCCTGTTGTTCCTCATT) and reverse (TCCATCCTGTTGTTCCTCATT), Fas cell surface death receptor (Fas/Cd95) forward (TATCAAGGAGGCCCATTTTGC) and reverse (TGTTTCCACTTCTAAACCATGCT), C-X-C motif chemokine ligand 12 (Cxcl12) forward (TGCATCAGTGACGGTAAACCA) and reverse (CACAGTTTGGAGTGTTGAGGAT), CD276 antigen (Cd276/B7h3) forward (AGCACTGTGGTTCTGCCTCACA) and reverse (CACCAGCTGTTTGGTATCTGTCAG), transforming growth factor beta 1 (Tgfb1) forward (CGGGTCTACTATGCTAAAGAGGTCAC) and reverse (TTTCTCATAGATGGCGTTGTTGC), and SMAD family member 3 (Smad3) forward (GCAGCCGTGGAACTTACAAGGC) and reverse (GGTAGACAGCCTCAAAGCCCTG).

Wound-healing assay

The 4T1 cells were seeded into 24-well plates (SPL, Korea) at 1.5×105 cells/well in RPMI 1640 medium supplemented with 10% FBS and cultured at 37°C with 5% CO2 for 24 h to form a monolayer. When the cells reached 80% confluence, the middle of the monolayer was scratched with a sterile 100 µL pipette tip and washed with phosphate-buffered saline to clear the scratch. Then, fresh G1–G12 medium was added to each well. After 24 h of culturing, wound closure was evaluated in three randomly selected fields in each well using an inverted microscope (Carl Zeiss Microscopy, LLC). The experiment was performed in triplicate for each group.

Cell morphology

The 4T1 cells were imaged at 5× and 10× magnification after treatment with various metformin and glucose concentrations. The 4T1 cells were seeded at a density of 5,000 cells/well in 96-well plates, and images were taken every 24 h for three days. The images were processed with Axio Vision software. All experiments were performed at least three times.

Statistical analysis

The data were analyzed using GraphPad Prism 8.0 software (GraphPad, USA). Data were compared between groups using Student’s t-test or one-way analysis of variance. The data are presented as mean ± standard deviation (SD). A P

Results The joint effect of metformin and glucose on 4T1 cell proliferation

The 4T1 mouse breast cancer cells showed considerable proliferation when cultured in G1, G4, G7, and G10 media that lacked metformin, particularly at higher (G10) than lower (G4 and G7) glucose concentrations. The 4T1 cells showed lower proliferation in the G2, G3, G5, G6, G8, G9, G11, and G12 media containing metformin than in the G1, G4, G7, and G10 media lacking metformin. In particular, the proliferation of 4T1 cells was significantly decreased in the G2, G3, G5, and G6 media, which combined metformin with low glucose concentrations (Figure 1). These results suggest that metformin inhibits 4T1 cell proliferation at any glucose concentration; the inhibition increased with the metformin concentration.

× Figure 1 . The proliferation of 4T1 mouse breast cancer cells under different concentrations of metformin and glucose . ( A ) The proliferation graph exhibited under different concentrations of metformin and glucose at 24, 48 and 72 hours. ( B ) The data exhibited the morphology of 4T1 under different concentrations of metformin and glucose at 24, 48 and 72 hours. Figure 1 . The proliferation of 4T1 mouse breast cancer cells under different concentrations of metformin and glucose . ( A ) The proliferation graph exhibited under different concentrations of metformin and glucose at 24, 48 and 72 hours. ( B ) The data exhibited the morphology of 4T1 under different concentrations of metformin and glucose at 24, 48 and 72 hours. × Figure 2 . The migration of 4T1 mouse breast cancer cells under different concentrations of metformin and glucose . ( A ) The graph depicted the migratory capability of the 4T1 cell line under different concentrations of metformin and glucose at 24 hours. ( B ) The data exhibited the morphology of 4T1 under different concentrations of metformin and glucose at 0 hours and 24 hours. Figure 2 . The migration of 4T1 mouse breast cancer cells under different concentrations of metformin and glucose . ( A ) The graph depicted the migratory capability of the 4T1 cell line under different concentrations of metformin and glucose at 24 hours. ( B ) The data exhibited the morphology of 4T1 under different concentrations of metformin and glucose at 0 hours and 24 hours. × Figure 3 . The expression of PD-L1 was evaluated in response to varying concentrations of glucose and metformin . Data were normalized to GAPDH levels. Experiments were repeated three times with similar data. Figure 3 . The expression of PD-L1 was evaluated in response to varying concentrations of glucose and metformin . Data were normalized to GAPDH levels. Experiments were repeated three times with similar data. × Figure 4 . The migration of 4T1 mouse breast cancer cells at 4.5 g/L glucose concentrations in 3 metformin concentrations including 0mM, 2mM and 5mM . ( A ) The data exhibited the morphology of 4T1 at 3 metformin concentrations under 4.5g/L glucose at 0 hours (1-3) and 24 hours (3-6). ( B ) The graph depicted the migratory capability of the 4T1 cell line under 3 different metformin concentrations at 24 hours (*P Figure 4 . The migration of 4T1 mouse breast cancer cells at 4.5 g/L glucose concentrations in 3 metformin concentrations including 0mM, 2mM and 5mM . ( A ) The data exhibited the morphology of 4T1 at 3 metformin concentrations under 4.5g/L glucose at 0 hours (1-3) and 24 hours (3-6). ( B ) The graph depicted the migratory capability of the 4T1 cell line under 3 different metformin concentrations at 24 hours (*P × Figure 5 . The proliferation of 4T1 cells under 3 metformin concentrations 0 mM, 2 mM, 5 mM at 4.5 g/L glucose concentration . ( A ) The 4T1 morphology during proliferation at 0 hours (1-3) and 24 hours (4-6). ( B ) The graph depicted the proliferation capability of the 4T1 cell line under 3 different metformin concentrations at 24 hours (*P Figure 5 . The proliferation of 4T1 cells under 3 metformin concentrations 0 mM, 2 mM, 5 mM at 4.5 g/L glucose concentration . ( A ) The 4T1 morphology during proliferation at 0 hours (1-3) and 24 hours (4-6). ( B ) The graph depicted the proliferation capability of the 4T1 cell line under 3 different metformin concentrations at 24 hours (*P The joint effect of metformin and glucose on 4T1 cell migration

The 4T1 mouse breast cancer cells cultured in G1, G4, G7, and G10 media lacking metformin showed strong migration abilities, particularly at higher glucose concentrations. The 4T1 cells showed lower migration when cultured in the G2, G3, G5, G6, G8, G9, and G12 media containing metformin than in the G1, G4, G7, and G10 media lacking metformin. In particular, while 4T1 cells cultured in the G2, G3, and G6 media shed and could not migrate, 4T1 cell migration was significantly decreased when cultured in the G5 medium, which combined metformin with a low glucose concentration. In contrast, 4T1 cells showed better migration when cultured in the G8, G9, G11, and G12 media, which combined high metformin and glucose concentrations. However, these groups migrated less than 4T1 cells cultured in media lacking metformin. These results indicate that metformin inhibits 4T1 cell migration at any glucose concentration; the inhibition increased with the metformin concentration (Figure 2).

The joint effect of metformin and glucose on Pd-l1 gene expression in 4T1 cells

Pd-l1 gene expression was similar in 4T1 cells cultured in G1, G4, G7, and G10 media lacking metformin. Interestingly, the media lacking glucose (G1, G2, and G3) but containing metformin did not affect Pd-l1 gene expression in 4T1 cells. However, in 4T1 cells cultured in media containing physiological (G7, G8, and G9) or low (G4, G5, and G6) glucose concentrations, Pd-l1 gene expression tended to increase with the metformin concentration. Interestingly, when considering only the media with the highest glucose concentration (G10, G11, and G12), Pd-l1 gene expression was significantly lower in 4T1 cells cultured in media containing metformin (G11 and G12) than lacking metformin (G10) (Figure 3). These results showed that metformin inhibits Pd-l1 gene expression in 4T1 cells at any glucose concentration; the inhibition increased with the metformin concentration.

× Figure 6 . The immune escape expression gene of 4T1 mouse breast cancer cells under 3 metformin concentrations at 4.5 g/L glucose . Gene express ( A ) CXCL-12; ( B ) B7-H3; ( C ) CD95 (*P Figure 6 . The immune escape expression gene of 4T1 mouse breast cancer cells under 3 metformin concentrations at 4.5 g/L glucose . Gene express ( A ) CXCL-12; ( B ) B7-H3; ( C ) CD95 (*P