Abstract

Introduction: The linkage between specific genetic variants and the susceptibility to dental caries remains a crucial area of investigation. This study aimed to examine the association of particular gene variants within MPPED2 (rs12797813), MTR (rs61739582), ACTN2 (rs6656267), and LPO (rs7209537) genes with the likelihood of developing dental caries.

Methods: The study recruited a cohort of 600 participants, divided equally between 300 individuals diagnosed with dental caries and 300 healthy controls devoid of the condition. The focus was on the genotyping of the mentioned gene variants using the Tetra-Primer Amplification Refractory Mutation System PCR (Tetra-ARMS-PCR) technique. This method is noted for its efficacy in detecting genetic variations.

Results: Analysis revealed significant associations between the occurrence of dental caries and the SNPs rs6656267 and rs7209537, with p-values less than 0.05 indicating statistical relevance. Notably, the presence of the C allele of rs6656267 and the A allele of rs7209537 was disproportionately higher amongst individuals with dental caries compared to the healthy control group. These associations were evident across both co-dominant and dominant genetic models, suggesting that these variants may increase the risk of developing dental caries. The discrepancy with the allele reference suggests a potential error in the citation of rs8178275, which likely should be rs7209537 based on the context provided.

Conclusion: The findings of this study suggest that the rs6656267 and rs7209537 variants in the ACTN2 and LPO genes, respectively, may serve as potential genetic markers for increased susceptibility to dental caries. However, the complex nature of genetic influences on dental caries risk necessitates further research to confirm these initial findings and to explore the mechanisms by which these SNPs influence caries development.

Introduction

Dental caries (DC), commonly known as tooth decay, is a chronic multifactorial condition that affects a large proportion of the population worldwide1. This condition arises from the interplay between oral bacteria, dietary carbohydrates, and various host factors, including saliva composition, tooth structure, and immune responses1. While behavioral and environmental factors play a crucial role in the development of DC, genetic influences have also been recognized as contributing to individual susceptibility2. Numerous genetic variations have been identified as potential contributors to a person's predisposition to developing DC. Among the genes studied in this context are metallophosphoesterase domain-containing 2 (MPPED2), methionine synthetase (MTR), alpha-actinin-2 (ACTN2), and lactoperoxidase (LPO). The MPPED2 gene, located on chromosome 11 (11p14.1), codes for a metallophosphoesterase. Although the precise function of this gene is not yet fully understood, it appears to be involved in the development of the nervous system3 and has been associated with aniridia 1, a congenital eye disorder4. Interestingly, while the MPPED2 gene does not have a known direct role in DC, a study has shown that its expression was significantly reduced (by a factor of 5) in oral epithelial cell lines exposed to bacterial pathogens. This finding suggests a potential indirect link between the MPPED2 gene and susceptibility to tooth decay5.

The enzymes methionine synthase reductase (MTRR) and MTR play a crucial role in the metabolic pathways involving folic acid, homocysteine, and vitamin B126. Previous studies have reported a relationship between vitamin B12 levels and the onset of DC7. Furthermore, cases with reduced concentrations of folic acid have been found to be more prone to caries development8. These findings collectively illustrate the prominent role of MTRR and MTR in the context of DC. It is known that gene polymorphisms can mediate the expression of MTRR and MTR, suggesting the potential involvement of MTRR and MTR gene polymorphisms in susceptibility to DC9.

The ACTN2 gene is responsible for the production of the alpha-actinin-2 protein, a cytoskeletal protein involved in the organization and stabilization of actin filaments in muscle cells10. Interestingly, ACTN2 is also expressed in odontoblasts, the cells that synthesize and secrete dentin, which constitutes the majority of the tooth structure beneath the enamel11. ACTN2 polymorphisms have been linked to various muscle-related disorders, such as hypertrophic cardiomyopathy and skeletal muscle myopathies12, 13. However, the role of ACTN2 in susceptibility to DC is not well-established, and the mechanisms by which ACTN2 polymorphisms might affect tooth structure or function are not fully understood14. It has been hypothesized that variants within ACTN2 may affect the binding affinity of ACTN2 to actin filaments or other proteins involved in dentin formation, thereby altering tooth structure and increasing the risk of DC14. Nevertheless, the available evidence on the association between ACTN2 gene polymorphisms and DC susceptibility is limited and conflicting, with some studies reporting positive associations and others finding no significant effects15, 16.

The LPO gene codes for a bactericidal salivary enzyme that plays a crucial role in protecting the lactating mammary gland and the intestinal tract of newborn infants against pathogenic microorganisms17, 18. In addition to its antimicrobial function, LPO has been reported to have other functions, such as growth-promotion activity and anti-tumor activity19, 20. Interestingly, a genome-wide association study (GWAS) focused on DC in children aged 3 to 12 years, examining their primary dentition, identified several novel genes, including LPO21. However, it is important to note that GWAS is a hypothesis-generating method, and the results require careful scrutiny and replication in independent samples to distinguish chance results from true associations.

To further elucidate the potential role of the MPPED2, MTR, ACTN2, and LPO genes in susceptibility to DC, additional studies are needed to investigate their functional effects on tooth development and to replicate the associations of their polymorphisms in different populations22. Such investigations could provide valuable insights into the genetic and molecular mechanisms underlying DC, which could inform the development of targeted prevention and treatment strategies for this common oral disease. In the present study, we aimed to investigate the potential association of specific single nucleotide polymorphisms (SNPs) within the MPPED2 (rs12797813), MTR (rs61739582), ACTN2 (rs6656267), and LPO (rs7209537) genes with susceptibility to DC in a population-based sample. Our findings could offer important insights into the genetic basis of DC and contribute to the development of personalized prevention and treatment approaches for this widespread oral health condition.

Table 1.

The primer sequences and Product size

Gene (SNP) Primers Sequence (3'-5') Product size ACTN2 (rs114880747) Forward inner primer (G allele) AGGTTTGCTATTTGTAAAAAATTTCATGTG For G allele: 191 Reverse inner primer (A allele) GGGGCAATCACATAAGCATATTAGATAT For A allele: 258 Forward outer primer (5' - 3') GCGCTTCATAAATAGGTTTATTTCTGAG Two outer primers: 391 Reverse outer primer (5' - 3') CCAAAAATCTTTTGGGTAGTCTTTTTAA LPO (rs8178275) Forward inner primer (G allele) GCTATTGCATCAACCAATCCCTGACG For G allele: 229 Reverse inner primer (A allele) GGCAGATACACCAGGAAACTGCAGCAT For A allele: 164 Forward outer primer (5' - 3') TTAAAAGGGACAAATGTGCTCAGGGCAT Two outer primers: 340 Reverse outer primer (5' - 3') TCTTACCTGCCCAGTGCCTTGTCTTTTC

Table 2.

Association of ACTN2 (rs114880747) and LPO (rs8178275 genotypes with decayed missing filled teeth score (dmft score) in DC cases

Gene (SNP) Genotype in DMFT Score n = 300 Decayed Missing Filled Teeth Score (DMFT score) p-value 1 DMFT 190 (63.35%) 2 DMFT 65 (21.6%) 3 DMFT 19 (6.3%) 4 DMFT 14 (4.6%) 5 DMFT 7 (2.33%) 6 DMFT 3 (1%) 7 DMFT 2 (0.66%) ACTN2 (rs114880747) AA 12 10 2 -