Prediction of H11 locus and Rosa26 targeting platform in goats based on cross-species genomic conservation

The genomic localization and sequence characteristics of the goat H11 locus were determined by integrating genomic database searches with literature analyses. First, a cross-species conservation analysis was performed using the chromosomal coordinates of the adjacent genes DRG1 and EIF4ENIF1 to map the goat H11 locus. Subsequently, multi-species (mouse, human, pig, sheep, and rabbit) H11 locus sequences were aligned using the BLAST tool on the NCBI platform to evaluate evolutionary conservation and sequence homology. Finally, the core sequence and flanking regulatory regions of the goat H11 locus were systematically predicted by combining the genomic localization data with cross-species conserved region analysis.

The goat Rosa26 sequence and its conserved features were identified through multispecies homologous alignment and genomic database analyses. Based on literature searches, mouse (NC_000072.6) and sheep Rosa26 sequences were retrieved. The Ensembl database was used for genomic localization, and the mouse 1 kb promoter and exon1 sequences were employed as probes to screen homologous regions in goats, successfully identifying goat Rosa26 exon1. Further systematic alignment of the full sheep Rosa26 sequence with the goat genome enabled prediction of the complete goat Rosa26 sequence. To validate evolutionary conservation, a multi-sequence alignment was performed to analyze the homology of exon1 across goat, mouse, and sheep Rosa26 genes, revealing species-specific sequence variations.

Reverse transcription quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extracted using RNAiso Plus (TaKaRa Bio, Kusatsu, Japan) and with a NanoDrop (Thermo Fisher Scientific, Waltham, MA, USA) spectrophotometer. Genomic DNA contamination was eliminated using gDNA Eraser (PrimeScript™ RT Reagent Kit) and verified via Melt curve analysis (single peak). cDNA was synthesized from 1 μg RNA using the PrimeScript RT Reagent Kit. RNA/cDNA were aliquoted and stored at –80 °C to prevent repeated freeze–thaw cycles. RT-qPCR was performed with TB Green® Premix Ex Taq™ II (TaKaRa Bio) on a CFX96 system using primers spanning exon-exon junctions (Supplementary Table S1). Data were analyzed via the 2−ΔΔCt method with three biological replicates per group (n = 3) and three technical replicates per sample. Experimental groups included CRISPR/Cas9-edited H11/Rosa26-integrated cells/embryos/animals (n = 3), with wild-type controls (n = 3). This workflow adhered to the MIQE guidelines (Bustin et al. 2009). The primer sequences are listed in Table S1.

Fibroblast cell culture

Goat fetal fibroblasts (GFFs) were isolated from 40-d-old embryos (Female) (Inner Mongolia Yiwei Cashmere Goat Co., Ltd., IACUC approval IMU-GOAT-2022–021) via tissue mincing and 0.25% trypsin digestion (30 min). Cells were cultured in DMEM/F12 supplemented with 10% FBS (Fetal Bovine Serum)and 1%(v/v) penicillin–streptomycin (100 × solution containing 10,000 U/mL penicillin and 10,000 μg/mL streptomycin) at 37 °C in a 5% CO2 incubator (Thermo Fisher Scientific) with real-time monitoring.

Polymerase chain reaction (PCR)

Genomic DNA was extracted from GFFs using the Genomic DNA Kit (Tiangen Biotech, Beijing, China) and quantified with a NanoDrop spectrophotometer. PCR was performed with PrimeSTAR® HS DNA Polymerase (TaKaRa Bio) in a 25 μL reaction containing 12.5 μL 2 × PrimeSTAR Buffer, 0.2 mM dNTPs, 0.4 μM primers, 100 ng template DNA, and 0.625 U enzyme. Thermocycling: 98 °C for 3 min, 35 cycles of 98 °C (10 s), primer-specific annealing (15 s), and 72 °C (1 min/kb), followed by 72 °C for 5 min. Products were resolved on 1% agarose gels (1 × TAE buffer, Invitrogen) stained with GelRed™ (0.2 μg/mL, Biotium) and visualized using the Gel Doc XR + system (Bio-Rad) with the Image Lab 6.0 (v6.0.1; Bio-Rad Laboratories, Hercules, CA, USA). Images were captured in TIFF format without post-processing. The primer sequences are listed in Table S2.

Construction of Cas9/gRNA co-expression vectors

The Capra hircus genome (NCBI: GCF_001704415.1) was used as a reference. Design tools included CRISPRdirect (DBCLS), CRISPOR, and CCTOP, with species-specific reference checks to ensure alignment with target sequences. Cas9/gRNA co-expression vectors were constructed using a commercial kit (Viewsolid Biotech, Beijing), with the oligos nucleotides shown in Table S3.

Plasmid purification and cloning validation:

Purification: Cas9/gRNA and EGFP-targeting plasmids were isolated via the PureYield Plasmid Midiprep System (Promega) and quantified using NanoDrop 2000 (Thermo Fisher Scientific).

Cloning verification: Sanger sequencing (BGI, China) using the vector-specific primer (sqprimer: TGAGCGTCGATTTTTGTGATGCTCGTCAG) confirmed the sequence of the inserted sgRNA fragment in the Cas9/gRNA co-expression vector. Sequences were aligned with reference loci (GenBank: H11 and Rosa26) to confirm accuracy.

Selection markers: The EGFP gene served as a selection marker and transfection efficiency indicator. In Escherichia coli transformations, ampicillin resistance (Ampr) was used for selection.

Precise evaluation of Cas9-sgRNA complex editing efficiency via TA cloning combined with Sanger sequencing

Cas9/gRNA co-expression vectors were transfected into 1 × 106 GFFs using the NEPA GENE electroporator (Model: NEPA21 TYPE II, 250 V, 2.5 ms, Opti-MEM, Gibco). Transfection efficiency was assessed using fluorescence microscopy (Nikon TI-S) and quantified with ImageJ (v1.53a) based on fluorescence intensity of reporter gene-expressing cells. Editing activity assessment: Genomic DNA extraction: Forty-eight hours post-transfection, target regions (H11 and Rosa26 loci) were amplified using primers (Supplementary Table S2) based on the C. hircus genome (GCF_001704415.1). TA cloning: PCR products were denatured and renatured to form heteroduplexes, ligated into pMD19-T vectors (TaKaRa Bio), and transformed into DH5α competent cells. Sequencing & analysis: Randomly selected clones (BGI Group) were sequenced, with indel frequencies and base substitutions calculated via BLAST alignment to the reference genome.Plasmid purification: Cloned plasmids were purified using the PureYield Plasmid Midiprep System (Promega).

Construction and validation of H11/Rosa26 HDR vectors

Based on TA cloning results, sgRNAs with optimal cleavage efficiency were selected. Homology arms (~ 1,000 bp each) flanking the sgRNA target sites were amplified using PrimeSTAR® HS DNA Polymerase (TaKaRa Bio) at locus-specific annealing temperatures of 68 °C (H11 left arm), 69.5 °C (H11 right arm), 67 °C (Rosa26 left arm), and 70 °C (Rosa26 right arm) (primers sequences: Supplementary Table S2). Vector construction: Using the pEGFP-C1 plasmid (Fenghui Shengwu, Shanghai) as the backbone, the upstream homology arm was inserted via PciI/AseI restriction sites upstream of the EGFP coding sequence.The downstream homology arm was inserted via MluI restriction sites downstream of the EGFP coding sequence. Final vector: ~ 1,000 bp upstream homology arm + CMV promoter + EGFP + polyA + ~ 1,000 bp downstream homology arm.Validation:

Correct vector assembly was confirmed by restriction enzyme digestion using PciI, MluI, and AseI. Sequence integrity and reading frame accuracy were verified by Sanger sequencing.

Cell recovery and cryopreservationCell recovery

Thaw cryopreservation tubes in 37 °C water bath, transfer cells to a centrifuge tube, and dilute cryoprotectant with 1:9 FBS/DMEM/F12 medium. Centrifuge (1200 rpm, 5 min), remove supernatant, resuspend in fresh 1:9 FBS/DMEM/F12 medium, and culture at 37 °C, 5% CO2, and saturated humidity.

Cell cryopreservation

Discard old medium, rinse with PBS, and digest cells with 0.25% trypsin (3 min, 37 °C). Terminate digestion with medium, centrifuge (1500 rpm, 5 min), and wash three times with PBS. Resuspend in 1:9 DMSO/FBS freezing solution, aliquot into cryovials, store at −80 °C for 24 h, then transfer to liquid nitrogen.

Flow cytometry sorting and EGFP-integrated monoclonal cell screening

Plasmids (Cas9/gRNA and EGFP-targeting vector) were purified using the PureYield Plasmid Midi Extraction System (Promega). GFFs (obtained from a single 40-d-old female goat embryo, passage 3, karyotype 46, XX) were transfected with the co-expression vectors under optimized electroporation conditions and cultured in 6 μM RAD51 stimulating compound 1 (RS-1, Selleck Chemicals) to improve HDR efficiency. Forty-eight hours after transfection, EGFP-positive single cells were sorted into 96-well plates using a Sony MA900 cell sorter (488 nm blue laser for SSC/FSC detection, high purity mode: 100 μm nozzle, 30 psi pressure). After confirmation via PCR/Sanger sequencing, they were used as donor cells for SCNT.

Off-target effect analysis

To ensure the safety of genome-edited goats, we predicted five potential off-target sites for sgRNAs targeting the H11 and Rosa26 loci using the CRISPOR algorithm (accessible at http://crispor.tefor.net/). PCR amplification followed by Sanger sequencing was performed to detect off-target effects at these sites. Predicted off-target loci and corresponding validation primers are detailed in Supplementary Tables S5, S6, and S7.

SCNT-mediated production of gene-edited cloned goatsOocyte collection and maturation

Ovaries from Alpine Cashmere Goats were collected from a commercial abattoir and transported in 30–35 °C saline (2–4 h). COCs (cumulus-oocyte complexes) were isolated by slicing ovarian follicles with a sterile scalpel into collection medium (pH 7.2–7.4, osmolality 280–300 mOsm/kg; recipe in Supplementary Table S8). On average, ~ 10 morphologically intact COCs (3 + layers of cumulus cells, uniform cytoplasm) were obtained per ovary pair. COCs were matured in vitro in maturation medium containing 1 μL/mL FSH (follicle-stimulating hormone; Ningbo Second Hormone Factory, China) and 1 μL/mL LH (luteinizing hormone; Ningbo Second Hormone Factory, China), with pH 7.2–7.4 and osmolality 280–300 mOsm/kg (full recipe in Supplementary Table S9). Maturation was performed at 38.5 °C under 5% CO2 for 24–30 h until first polar body extrusion (MII stage).

Reconstructed embryo construction

Donor cells (H11/Rosa26-EGFP-integrated fibroblasts) were cultured in DMEM/F12 + 20% FBS (VivaCell, China). MII oocytes were denuded with 0.1% hyaluronidase (Sigma, Germany) and enucleated in 0.025 mg/mL cytochalasin B (CCB, Sigma, Germany)-containing IVC medium using a micromani-pulator (removing ~ 1/3 cytoplasm + polar body). G0/G1-phase donor cells were injected into the perivitelline space to form reconstructed embryos.

Embryo activation and culture

Reconstructed embryos were activated with 5 μM Ionomycin (Sigma, Germany) in IVC medium (pH 7.2–7.4, osmolality 280–300 mOsm/kg; recipe in Supplementary Table S10) for 5 min, followed by 3.5 h in SOFaa + 2 mM 6-DMAP (Sigma, Germany) to inhibit polar body emission. Post-activation, embryos were cultured in embryo development medium (pH 7.2–7.4, osmolality 280–300 mOsm/kg; 38.5 °C, 5% CO2, 5% O2) until the 2–8-cell stage.

Embryo transfer and monitoring

Healthy 2–5-year-old does were synchronized with embryo developmental stages. Embryos were surgically transferred into the ampulla of the oviduct at the side of a corpus luteum or ovulation. Pregnancy was monitored via ultrasound (30, 60, and 90 d post-transfer). Postpartum, genomic integration of H11-EGFP and Rosa26-EGFP was verified via PCR and Sanger sequencing (Supplementary Table S2).

Western blotting

Total protein was extracted using a mammalian protein extraction kit (CWBIO) and quantified via BCA assay (Thermo Fisher Scientific). For denaturation, 10 μg protein/lane was boiled in 5 × SDS Loading Buffer (Tris–HCl, SDS, glycerol, bromophenol blue, DTT) at 100 °C for 5–10 min. Proteins were separated on homemade 5% polyacrylamide gels (SDS-PAGE) and transferred to nitrocellulose membranes (0.45 μm pore size) using Tris–Glycine Transfer Buffer (Kangwei Century, China). Membranes were blocked with 5% skim milk and probed with primary antibodies against EGFP (1:3,000), and α-tubulin (1:5,000, internal loading control; all from Proteintech). After three 15 min TBST washes (Tris-buffered saline with 0.1% Tween 20), HRP-conjugated secondary antibodies (1:5,000) were applied. Signals were detected with ECL substrate (Thermo Fisher Scientific) and visualized via the Tanon 5200 imaging system (Tanon). β-actin normalized loading and transfer efficiency.

Fluorescence microscopy of EGFP expression in nuclear transfer embryos

EGFP expression was monitored using an inverted fluorescence microscope (Nikon TI-S) with EGFP-specific filters.

Tissue fluorescence detection

Cornual tissues were analyzed for EGFP intensity using a fluorescence imaging system with a 488 nm excitation light source (laser/LED). Owing to the constraints of rapid on-site imaging, physical scale markers were not included—this represents a limitation of the data presented. Postnatally cloned goats (transgenic/cloned) were euthanized at 1 year of age by intravenous injection of sodium pentobarbital (30 mg/kg), followed immediately by systemic perfusion with ice-cold PBS (4 °C) to clear blood. Key tissues including quadriceps femoris (muscle), left hepatic lobe (liver), and left ventricle (heart), were rapidly collected and processed via tissue fixation with 4% PFA (Solarbio, ready-to-use) at 4 °C for 24 h, followed by 1 × PBS rinsing. Histology procedure: Dehydration: Gradient ethanol (70% → 100%, 40 min–1 h/step); Clearing: Xylene (1:1 ethanol/xylene → pure xylene, 30 min/step). Paraffin embedding: 3 × molten paraffin infiltration (1 h/step), oriented embedding in molds, cooled at 4 °C. Sectioning: 5 μm sections cut via microtome, mounted on APES-coated slides, dried at 37 °C overnight after spreading at 42 °C. EGFP distribution was visualized under a Nikon TI-S fluorescence microscope, and fluorescence intensity (relative fluorescence units, RFU) was quantified using ImageJ and normalized against a wild-type negative control (a contemporaneous wild-type clone) (Animal Ethics Approval: IMU-GOAT-2022–021).

Cell cycle analysis via PI staining and flow cytometry

For cell cycle analysis, three groups were tested: (1) wild-type (WT) cells (blank controls), (2) negative control (NC) cells transfected with empty vector plasmid, and (3) experimental groups with targeted integration at H11 or Rosa26 loci. Fixation: 1 × 106 cells were fixed in 1 mL ice-cold 70% ethanol overnight at 4 °C. Centrifugation and washing: Cells were pelleted (1,500 rpm, 5 min), resuspended in 1 mL ice-cold PBS, and centrifuged again under identical conditions.Staining: Pellets were stained with PI/RNase A solution (25 μL PI stock + 20 μL RNase A in 1 mL staining buffer; 200–300 μL per sample) and incubated at 37 °C for 30 min in the dark.Flow cytometry: Analyzed using BD FACSCanto II (488 nm excitation), acquiring 30,000 events per sample. Gating was based on FSC/SSC to exclude debris/aggregates. Data Analysis: Performed using FlowJo v10.8.

Apoptosis detection via Annexin-V/7-AAD staining

Apoptosis was assessed using Annexin-V-PE (5 μL) and 7-AAD (10 μL, 20 μg/mL) staining on 1 × 106 GFFs. Cells were incubated with Annexin-V-PE in the dark for 5 min at 20–25 °C, followed by immediate 7-AAD addition before analysis on a BD FACSCanto II flow cytometer (488 nm excitation, PE 575/26 nm filter for Annexin-V-PE, 7-AAD 670 nm long pass filter). A minimum of 30,000 events per sample were acquired, with debris excluded via FSC/SSC gating and fluorescence data analyzed to distinguish early (Annexin-V-PE positive/7-AAD negative) and late/necrotic (Annexin-V-PE positive/7-AAD positive) apoptotic cells. AnnexinV-PE binds phos-phatidylserine on apoptotic membranes, while 7-AAD stains permeabilized cells. Controls included unstained cells, single-stained samples (AnnexinV-PE only or 7-AAD only), and EGFP-transfected cells without staining.

CCK-8 assay for cell proliferation

Cells (5 × 103/well) were seeded in 96-well plates and cultured for 24 to 120 h. Cell viability was assessed using 10% CCK-8 (diluted in regular cell culture medium; Yeasen Biotechnology) at a concentration of 110 µL/well. Absorbance at 450 nm was measured using a Thermo Scientific microplate reader (model: 300–1993), and background correction was performed using a blank control (culture medium + CCK-8 without cells). Data are presented as mean ± SD/SE (each condition was repeated three times), and statistical significance was determined by analysis of variance. Cell viability was calculated as follows:

$$\text()=\frac}_\right)}-}_\right)}\right]}}_\right)}-}_\right)}\right]}\times 100$$

Developmental assessment of SCNT embryos

SCNT embryos were constructed by transferring donor cell nuclei (from WT or edited female goat fibroblasts; n = 3 independent cell lines per genotype) into enucleated oocytes. Oocyte enucleation was performed via microinjection in CCB-supplemented medium, and nuclear transfer was completed by electrofusion using an ECM 2001 system (BTX; 1.5 kV/cm, 30 μs, 2 pulses). Embryos were cultured in SOFaa-based IVCmedium at 38.5 °C under 5% CO2. Developmental progression (2-cell, 4-cell, 8-cell) was monitored every 12 h using a Nikon TI-S inverted microscope equipped with a 38.5 °C heating stage.

The cleavage rate was calculated as follows:

$$\text\left(\right)=\frac}}\times 100$$

Note: Embryonic development timelines were referenced against internal standards derived from the average of three WT goat SCNT cohorts owing to the absence of published benchmarks.

Growth phenotype monitoring

Body weight, length, height, and chest circumference were measured in transgenic and WT goats at birth, 6 months, and 12 months using electronic scales (± 0.1 kg) and tape measures (± 0.5 cm). Data were analyzed descriptively.

Ethics

All of these experiments were conducted in accordance with the National Research Council’s Guide for the Care and Use of Laboratory Animals. All protocols were approved by the Experimental Animal Care and Use Committee of Inner Mongolia University (protocol code IMU-GOAT-2022–021). All animal procedures were performed at Inner Mongolia Yiwei Cashmere Goat Co., Ltd.

Statistical analysis

Intergroup comparisons of continuous variables were performed using independent samples t-tests (for two groups) or one-way analysis of variance (ANOVA) (for three or more groups). Data are presented as mean ± standard deviation (mean ± SD). Statistical significance was set at *α = 0.05*. Results are reported with t/F-values and exact p-values. Analyses were conducted using Prism 8.0 (GraphPad Software, San Diego, CA, USA).