INTRODUCTION

In the context of the global obesity epidemic and its associated metabolic disorders, gestational diabetes mellitus (GDM) is acknowledged as the most prevailing complication related to pregnancy. It is characterized by glucose intolerance that emerges during gestation. This condition is linked to several adverse outcomes, including preterm birth, increased incidence of cesarean deliveries, and development of preeclampsia.[1] Furthermore, antenatal exposure to maternal hyperglycemia can result in fetal hyperinsulinemia, increasing the probability of macrosomia, neonatal hypoglycemia, and hyperbilirubinemia.

In GDM, pancreatic β-cells were incapable of sufficiently making compensation for the increased insulin resistance (IR), leading to the normalization of systemic glucose levels and, ultimately, maternal hyperglycemia.[2] GDM is recognized as a multifactorial condition, with significant contributions from internal genetic and external environmental factors.[3] A hyperglycemic environment is associated with oxidative stress, and GDM leads to elevated levels of oxidative stress compared with those without complications, which exposes the embryo and fetus to harmful effects.[4]

A recent research highlighted a strong association between alterations in the gut microbiome of obese women during early pregnancy and changes in metabolic hormones.[5] Overweight pregnant women have an increased prevalence of pathogenic bacteria, such as Enterobacteriaceae and Staphylococcus, alongside a decrease in beneficial bacteria, such as Bifidobacteria and Bacteroides.[6] Several reports indicate significant changes in the gut microbiome of women with GDM, which are very similar to the microbiome characteristics observed in adults with non-insulin-dependent diabetes or so-called type II diabetes mellitus.[7-9] Probiotic interventions, including Lactobacillus rhamnosus GG and Bifidobacterium animalis subsp. lactis BB-12, in conjunction with dietary changes, have demonstrated efficacy in reducing the risk of GDM. Therefore, the gut microbiome may serve as a potential biomarker for impaired glucose metabolism during pregnancy, and its modulation could represent a promising strategy for improving health outcomes in women with GDM.

Sodium alginate is a linear acidic polysaccharide that possesses chelating, gelling, and hydrophilic properties, which confer its extensive applications in the food, cosmetics, and biomedical industries. Emerging evidence suggests that sodium alginate can function as a therapeutic adjuvant to enhance antitumor immune responses against various cancers, including ovarian cancer and melanoma.[10] However, its applications in biomedicine are significantly constrained by its low bioavailability. To address these challenges, sodium alginate can be artificially degraded to produce low-molecular-weight, low-viscosity alginate oligosaccharides (AOS), which exhibit improved solubility and bioavailability.

Consequently, AOS has garnered considerable attention for its enhanced pharmacological activity and beneficial effects in biomedical applications.[11] Furthermore, AOS demonstrates a diverse range of pharmacological effects, including antioxidant properties,[12] immune response modulation,[13] and lipid reduction.[14] The pharmacological effects of AOS align with the etiological factors associated with GDM, indicating its potential use as a treatment for this condition. Nevertheless, research investigating the efficacy of AOS in alleviating GDM remains limited.

In this investigation, we seek to clarify the impacts and biological mechanisms of AOS in GDM using a drug-induced mouse model of diabetes. We evaluated changes in blood glucose levels, gut microbiota composition, IR, pancreatic cell apoptosis, and liver gluconeogenesis following AOS treatment. The findings suggest that AOS effectively reduces IR, pancreatic cell apoptosis, and liver gluconeogenesis by alleviating oxidative stress and enhancing gut microbiota in mice with GDM. Results indicate that AOS may represent a viable treatment option for GDM and has potential clinical implications.

MATERIAL AND METHODS Establish GDM mouse models

Diabetes mouse models were constructed based on previous literature.[15] Ninety 8 ± 2 weeks old C57BL/6J female mice, which weighed 23 ± 2 g, were obtained (Guangdong Experimental Animal Center, Guangzhou, China). The mice were kept in an environment regulated to approximately 25°C, with relative humidity levels fluctuating between 38% and 68%, and were subjected to natural light exposure. They were provided with standard laboratory chow with a completely unrestricted food and water supply. The experimental procedures began following a 1-week acclimatization period.

A mouse model of GDM was developed by the administration of streptozotocin (STZ, V900890, Sigma-Aldrich, St. Louis, USA) through the intraperitoneal route. Before the initiation of experimental procedures, venous blood samples were obtained from the tails of the mice to evaluate fasting blood glucose (FBG) levels, with a normal range defined as 3-5 mmol/L. Glucose oxidase was measured using a Glucose Assay Kit (MAK476, Sigma-Aldrich, St. Louis, USA). These measurements were performed using an automatic biochemical analyzer (7180, Hitachi, Tokyo, Japan). The estrous cycle of the mice was monitored utilizing the vaginal smear technique. In the initial stage of estrus, mice were matched pairs for copulation, and the emergence of a vaginal plug was assessed the following morning to confirm successful mating. The detection of the vaginal plug marks the 1st day of pregnancy. Eighty-two pregnant mice were in abrosia for 12-h while they were permitted free access to water on the 6th day of pregnancy. Ten mice were randomly selected for the control group, while 72 mice were placed into the GDM group. At 7 days post-modeling, an FBG level of ≥ 11.1 mmol/L was determined to be the significant symbol of the establishment of the GDM model. These mice were given 3 mg/kg AOS every day by oral gavage. Deltamethrin (5.6 mg/kg, 45423, Sigma-Aldrich, St.Louis, USA) was treated by oral gavage.

Animal anesthesia and euthanasia

To minimize distress experienced by experimental animals during procedures, this study utilized pentobarbital sodium (P3761, Sigma-Aldrich, St. Louis, USA) as an anesthetic agent. The anesthetic effects of pentobarbital sodium are relatively short-lived, with an effective duration of approximately 2-4 h following a single dose. For administration, a 2% pentobarbital sodium solution was prepared using physiological saline, which may be warmed if necessary to facilitate dissolution. The prepared solution was stored at room temperature for a maximum of 2 months without significant loss of potency. The mice received anesthesia through intraperitoneal injection of 40-45 mg/kg pentobarbital sodium.

To mitigate stress and suffering in murine subjects, researchers must undergo specialized training and successfully complete an evaluation before employing the euthanasia technique. During the procedure, the mouse is positioned on a wire mesh surface while the experimenter secures the mouse’s tail with one hand. With the thumb and index finger of the opposite hand, the experimenter applies swift and forceful pressure to the mouse’s head. Tweezers may be used to grasp the mouse’s neck, followed by a pulling motion to dislocate the cervical vertebrae.

Hematoxylin and eosin (HE) staining

Pancreatic tissue of mice in each experimental group was collected. The tissues were fixed with a 4% paraformaldehyde fixative solution (P0099, Beyotime, Shanghai, China), followed by decalcification, paraffin embedding, and storage at 4°C. Following the sectioning of the tissues into 5 μm slices, HE staining was performed utilizing a HE Staining Kit (C0105S, Beyotime, Shanghai, China). The sections were subjected to hematoxylin staining for 10 min and immersed in 70% ethanol (65350-M, Sigma-Aldrich, St. Louis, USA) for 30 min to remove cytoplasmic coloration. Following alkalization, the tissue sections were subjected to eosin staining for 60 s, dehydrated through a series of ethanol gradients, and cleared twice using Stoddard solvent (ST975, Beyotime, Shanghai, China). The samples were then dried for further analysis. The morphological particularity of the pancreas was assessed utilizing an optical microscope (B-510ASB, Optika, Shanghai, China). The nuclei were predominantly stained a black-blue color, while the cytoplasm exhibited a pale red hue.

Terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) assay

After treatment for 6 weeks, the pancreas of mice in each experimental group was surgically removed, collected, and subjected to staining using TUNEL Apoptosis Detection Kit (C1091, Beyotime, Shanghai, China). The stained tissues were subsequently examined with an optical microscope. Five high-power fields demonstrating the greatest quantity of positively stained cells, as indicated by brown-stained nuclei, were selected from each group at a magnification of ×400.

Detection of biochemical indicators

Venous blood samples were collected from the tails of mice in each experimental group 1 day before euthanasia. The samples were centrifuged (12,000 rpm, 15 min) to boost the separation of the serum. FBG levels were assessed. Serum fasting insulin (FINS) levels were determined using a mouse insulin enzyme-linked immunosorbent assay (ELISA) kit (E03I0004, Bluegene, Shanghai, China). The values of FBG and FINS that were obtained were subsequently employed to compute and evaluate the homeostasis model assessment (HOMA) indices, which specifically pertain to Homeostatic Model Assessment of Insulin Resistance (HOMA-IRI), islet β-cell function (HOMA-β%) and insulin sensitivity (HOMA-ISI). Blood parameters were assessed through glucose tolerance tests and insulin tolerance tests. Serum samples were obtained by subjecting blood to centrifugation (1,000 g, 10 min, and 4°C). Liver tissue samples were collected for biochemical assessments. Blood lipid markers, such as serum total cholesterol (TChl) and triglycerides (TG), were assessed using specific detection kits (TChl: Amplex Red Cholesterol and Cholesteryl Ester Assay Kit, S0211S, Beyotime, Shanghai, China; TG: Amplex Red TG Assay Kit, S0219S, Beyotime, Shanghai, China; High-Density Lipoprotein Cholesterol Content Assay Kit, 60737ES, Yeasen, Shanghai, China; LDL: Low-Density Lipoprotein Cholesterol Content Assay kit, 60736ES, Yeasen, Shanghai, China; Malondialdehyde [MDA]: Colorimetric MDA assay kit,60745ES, Yeasen, Shanghai, China). Liver lysates were prepared following a standardized protocol, and the levels of MDA, superoxide dismutase (SOD), glutathione peroxidase (GPx), glutathione (GSH), and catalase (CAT) in the hepatic tissue were measured using detection kits (SOD: Total SOD Assay Kit with WST-8, S0101S, Beyotime, Shanghai, China; GPx: Cellular GPx Assay Kit with NADPH, S0056, Beyotime, Shanghai, China; GSH: Total GSH Assay Kit, S0059S, Beyotime, Shanghai, China; CAT Assay Kit, S0051, Beyotime, Shanghai, China).

Reverse-transcription polymerase chain reaction (RT-PCR)

Total RNA was isolated from the harvested hepatic tissues using the RNA Easy Fast kit (DP451, TianGen, Beijing, China) and applied to synthesize complementary DNA (cDNA) with Hieff NGS® ds-cDNA Synthesis Kit (13488ES24, Yeasen, Shanghai, China). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was utilized as the internal control. All primers utilized in this study were synthesized by Qingke Biotech (Guangzhou, China) [Table 1].[16] The relative messenger ribonucleic acid (mRNA) expression levels of the target genes were assessed through quantitative RT-PCR (qRT-PCR) using a BeyoFast™ Synergetic Binding Reagent Green One-Step qRT-PCR Kit (D7268S, Beyotime, Shanghai, China). The ΔΔCt method was employed to calculate relative mRNA expression levels in comparison with the control group.

Table 1: Primers for RT-qPCR.

Gene Forward (5'-3') Reverse (5'-3') G-6-Pase CACCTGTGAGACCGGACCA GACCATAACATAGTATACACCTGCTGC GLUT2 TACGGCAATGGCTTTATC CCTCCTGCAACTTCTCAAT PEPCK GACCATAACATAGTATACACCTGCTGC AGAAGGGTCGCATGGCAA GAPDH AATGGTGAAGGTCGGTGTGAACG TCGCTCCTGGAAGATGGTGATGG Western blot analysis

Nuclear and cytoplasmic proteins were isolated using a Nuclear and Cytoplasmic Protein Extraction Kit (P0027, Beyotime, Shanghai, China). Two buffer solutions were formulated, designated as buffer A and buffer B. Buffer A is composed of 10 mM Tris-HCl (pH 7.4), 5 mM MgCl2, and 250 mM sucrose, whereas buffer B comprises 10 mM Tris-HCl (pH 7.4), 1 mM MgCl2, and 2 M sucrose. About 500 mg of liver tissue was homogenized using a 40 μm cell filter in 2 mL of ice-cold buffer A to generate a liver nuclear lysate. Following centrifugation (500 g, 15 min, and 4°C) and washing with buffer A, the resultant pellet was resuspended in 8 times its volume of buffer B. The mixture was then centrifuged (16,000 g, 30 min, and 4°C). The upper brown layer was abandoned, and the white pellet at the bottom was retained. The granules in the bottom layer (white) are the nuclei, while those in the upper brown layer are cytoplasm. We prepared samples of nuclear protein and total cellular protein as described. A total of 30 μg of the protein in each group was subjected to separation using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) Gel Quick Preparation Kit (P0012AC, Beyotime, Shanghai, China) and transferred to a polyvinylidene fluoride membrane (IPFL00010, Millipore, USA). The membrane was blocked with 5% skim milk in ×1 Tris-buffered saline (TBS) (ST661, Beyotime, Shanghai, China) for 1 h. The membranes were subjected to an overnight incubation at 4°C with primary antibodies, after which they were washed 3 times with 0.05% Tween-20 in TBS. The membranes were then treated with horseradish peroxidase-labeled goat anti-rabbit Immunoglobulin G (H + L) (A0208, Beyotime Biotechnology, China) for 1 h. Following a 1-min incubation period with the enhanced chemiluminescence (ECL) solution (36222, Yeasen, Shanghai, China), the resultant signals were measured utilizing an ECL detection system (ImageQuant LAS 4000, GE, Boston, USA). The blots were probed with the following primary antibodies: Rabbit anti-rat nuclear respiratory factor 2 (Nrf2) (1:1000) (#ab313825, Abcam, Cambridge, UK) and rabbit anti-rat Heme oxygenase 1 (HO-1) (1:10000) (#ab189491, Abcam, Cambridge, UK) as well as rabbit anti-rat histone 3 antibody (1:2000) (#60538, CST, Danvers, USA) and rabbit anti-rat β-actin (1:5000) (#ab179467, Abcam, Cambridge, UK). The T-test method was employed to calculate relative protein expression levels in comparison with the control group.

Intestinal microbiota composition analysis

In accordance with the manufacturer’s protocols, genomic DNA was extracted from the entire microbial community utilizing the MolPure® Stool DNA Kit (18820E, Yeasen, Shanghai, China). The bacterial DNA extraction protocol utilized modified variants of the upstream primer 338F (5'-ATCCTACGGGGGCAGCAG-3') and the downstream primer 806R (5'-GGATCAVGGGTWTCTAAT-3') to amplify the V3-V4 hypervariable region of the 16S ribosomal ribonucleic acid gene. Polymerase chain reaction (PCR) amplification was conducted using the ETC821D PCR thermal cycler (Eastwin, Beijing, China). The purified PCR products were subsequently processed with the NEXTFLEX Rapid DNA-Seq Kit (5144-08, Bioo Scientific, Austin, USA) and sequenced on the Illumina MiSeq PE300 platform (Illumina, San Diego, CA). The sequencing data were analyzed by Qingke Biotech (Guangzhou, China).

Cell culture and treatment

The human-derived normal liver cell line (QSG 7701) was purchased from Biyun Tian Biotechnology Co., Ltd. (Shanghai, China) and identified by short tandem repeat. MycAwayTM Plus-Color One-Step Mycoplasma Detection Kit (40612E, Yeasen, Shanghai, China) was used to detect mycoplasma, and no contamination was found. QSG 7701 cells were cultured using Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum (12103C, Sigma-Aldrich, St. Louis, USA), 1% penicillin, and 1% streptomycin at 37°C under an atmosphere of 5% Carbon dioxide. The cells were treated at a density of approximately 80%. We employed high-glucose (30 mmol/L) treatment for 48 h to induce damage in QSG 7701 cells, thereby modeling the hepatic injury associated with glucose dysregulation in the organism. Low glucose concentration (11.1 mmol/L) was used act as the control group. High-glucose QSG 7701 cells treated with 0.05, 0.1, 0.2, and 0.3 nM AOS were harvested at 48 h. Cell viability was assessed after 48 h of treatment.

Methylthiazolyldiphenyl-tetrazolium bromide (MTT) assay

Cells were initially plated at a density of 5 × 105 cells per well in six-well plates. After 24 h, the cells were incubated with varying concentrations of AOS (0.05, 0.1, 0.2, and 0.3 nM) and re-plated at a density of 1 × 104 cells per well in 96-well plates. After being incubated under low- and high-glucose conditions for an additional 48 h, 10 μL of MTT solution (5 mg/mL) was added to each well, and the plates were incubated at 37°C for 2 h. Each well was added with 200 μL of dimethyl sulfoxide and incubated again for 30 min. Cell viability was determined by recording the absorbance at 570 nm using a microplate reader (1681130, Bio-rad, California, USA). Cell counts were expressed as a percentage relative to the control group.

ELISA

Blood samples were centrifuged at 750 g for 20 min. The serum was separated and stored at −80°C. The levels of interleukin (IL)-1β, IL-6, and tumor necrosis factor-α (TNF-α) in the mouse serum samples were analyzed using sandwich ELISA kits (Mouse IL-1β: MM-0040M1, mmbio, Jiangsu, CHINA; mouse IL-6:MM-1011M2, mmbio, Jiangsu, CHINA; mouse TNF-α: MM-0132M2, mmbio, Jiangsu, CHINA) in accordance with the supplier’s protocol. The data were plotted as bar graphs.

Reactive oxygen species (ROS) assay

QSG 7701 cells were inoculated into a six-well plate at a concentration of 5 × 105 cells per well to ensure that the cell confluence reached 50-70% during detection.

The cells should be healthy and not overgrown during the experiment. The cells were treated according to the aforementioned experimental protocol and incubated in a 37°C cell culture incubator in the dark for 48 h. ROS assay was conducted using a ROS assay kit (S0033S, Beyotime, Shanghai, China). Before loading the probe, 2',7'– dichlorofluorescein diacetate (DCFH-DA) was diluted with serum-free culture medium at a ratio of 1:1000 to achieve a final concentration of 10 μM. The cell culture medium was removed and added with 1000 μL of the diluted DCFH-DA working solution. The cells were incubated at 37°C in a dark incubator for 20-30 min and washed 3 times with serum-free culture medium to thoroughly remove any unincorporated DCFHDA. Finally, the cells were observed under a fluorescence microscope (MIX60-FL, Mshot, Guangzhou, China).

Statistical analysis

The Statistical Package for the Social Sciences version 21.0 (IBM Corp., Armonk, NY, USA) was used for statistical analyses.

Results are expressed as mean ± standard deviation. Before analysis, all data were evaluated for normality and homogeneity of variance. Comparisons between two groups were executed using t-test, whereas comparisons among multiple groups were carried out using a one-way analysis of variance. P < 0.05 was deemed statistically significant, with significance levels indicated as ✶P < 0.05, ✶✶P < 0.01, and ✶✶✶P < 0.001 compared with the control group.

RESULTS AOS alleviates symptoms associated with hyperlipidemia resulting from GDM

Following the modeling procedure, all random blood glucose levels exceeded 16.7 mmol/L and were associated with symptoms, including polydipsia, polyphagia, and polyuria, indicating that the modeling was successful. In the animal model used for investigation, all mice administered with STZ exhibited fasting blood sugar levels surpassing 16.7 mmol/L, thereby confirming the efficacy of the modeling process. The concentrations of not only IL-6 but also TNF-α in the diabetes/AOS group were dramatically lower than those observed in the control group [Figure 1a]. Moreover, TCh, TG, LDL, and the atherosclerosis index in diabetes/AOS mice were prominently descended compared with the diabetes/ control group [Figure 1b-f]. All these align with the results of the glucose/insulin tolerance test, further substantiating the hypothesis that AOS supplementation improves biochemical indicators and promotes metabolic balance in GDM mice.

Figure 1: AOS alleviates symptoms associated with hyperlipidemia resulting from GDM. (a) Protein level of hyperlipidemia-related protein adiponectin, IL-6, and TNF-α. (b-e) Levels of total TCh, serum TG, serum HDL, and serum LDL in AOS-treated pregnant mice. (f) Atherosclerosis index of AOS-treated pregnant mice. The experiment was repeated 3 times. Ctrl: Control, AOS: Alginate oligosaccharides, IL-6: Interleukin-6, TNF-α: Tumor necrosis factor-α, β-Actin: Actin beta; GDM: Gestational diabetes mellitus, TCh: Cholesterol, TG: Triglycerides, LDL: Low-density lipoprotein, HDL: High-density lipoprotein. ✶✶✶P < 0.001, NS: Non-significant

Export to PPT

AOS mitigates oxidative stress in GDM mice

The serum and liver levels of MDA in diabetic and control mice were elevated relative to the wild-type group; however, these levels exhibited a significant reduction following AOS treatment, mirroring the trends observed in the astaxanthin-treated cohort [Figure 2a and b]. In addition, the study analyzed the activity of critical antioxidant enzymes, such as SOD, in the liver. Treatment with AOS significantly improved the functionality of antioxidant defenses in pregnant mice in comparison with untreated diabetic/control mice, consistent with the outcomes observed in the positive control group, while levels of GSH were markedly increased in the hepatic tissue of diabetic/control mice treated with AOS [Figure 2c-f]. These findings indicate that AOS mitigates oxidative stress in GDM mouse models.

Figure 2: AOS mitigates maternal oxidative stress in GDM mice. (a-f) Levels of oxidative stress markers in AOS-treated pregnant mice. (a) Serum MDA, (b) liver MDA, (c) liver SOD, (d) liver GPx, (e) liver GSH, and (f) liver CAT. Ctrl: Control, AOS: Alginate oligosaccharides, GDM: Gestational diabetes mellitus, MDA: Malondialdehyde, SOD: Superoxide dismutase, GPx: Glutathione peroxidase, GSH: Glutathione, CAT: Catalase. ✶✶✶P < 0.001.

Export to PPT

AOS enhances the balance of gut microbiota dysbiosis

The fecal microbiota diversity and abundance in GDM mice were markedly diminished compared to those in the control group, while values of Shannon, Chao, and ACE indices increased following the administration of AOS [Figure 3a-d], indicating an enhancement in the abundance of the fecal microbiota. However, no significant changes in the diversity of the fecal microbiota were detected. Furthermore, β-diversity analysis revealed a reorganization of the gut microbiota subsequent to AOS treatment. The impact of AOS on the quantity of the gut microbiota was evaluated. The findings revealed notable inconsistencies in microbial components among various animal groups studied. In particular, the abundance of Verrucomicrobia and Akkermansia remarkably increased following AOS treatment, while the abundance of Proteobacteria, Klebsiella, Shigella, and Mucispirillum significantly decreased [Figure 3e-l]. Thus, AOS treatment plays a crucial role in mitigating dysbiosis within the gut microbiota.

Figure 3: AOS improves the gut microbiota of GDM mice. (a) Shannon index, (b) Simpson index, (c) ACE index, (d) Chao index, (e) Proteobacteria, (f) Verrucomicrobiota, (g) Akkermansia, (h) Klebsiella, (i) Marvinbryantia, (j) Blautia, (k) Escherichia-Shigella, (l) Eubacterium xylanophilum_ group. ACE index: Abundance-based coverage estimator index, WT: Wild type, Ctrl: Control, AOS: Alginate oligosaccharides, GDM: Gestational diabetes mellitus.✶✶✶P < 0.001.

Export to PPT

AOS stimulates the Nrf2/HO-1 signaling pathway in GDM mice

The Nrf2/HO-1 signaling pathway is acknowledged as a critical regulator in antioxidant gene transcription and in maintaining redox homeostasis. Here, we examined the activation of the Nrf2/HO-1 signaling pathway, a vital role in maintaining redox homeostasis, in the hepatic tissue of GDM mice subjected to AOS treatment through Western blot analysis. Nrf2 expression in nuclear increased in the diabetic mice compared with that in wild-type mice, indicating a suppression of the Nrf2-dependent gene HO-1 [Figure 4a]. HO-1 is critical for heme detoxification and protection against oxidative stress. By contrast, the administration of AOS markedly elevated the levels of nuclear Nrf2 and HO-1 in the diabetic/control group mice [Figure 4b].

Figure 4: AOS activates the Nrf2/HO-1 signaling pathway in GDM mice. (a) Nucleus Nrf2 and (b) expression of HO-1 in GDM mice treated with AOS. The experiment was conducted in triplicate. WT: Wild type, Ctrl: Control, AOS: Alginate oligosaccharides, GDM: Gestational diabetes mellitus, Nrf2: Nuclear respiratory factor 2, HO-1: Heme oxygenase 1, β-Actin: Actin beta. ✶✶✶P < 0.001.

Export to PPT

AOS reduces pancreatic cell apoptosis in GDM mice

Pathological changes in the pancreas associated with different treatment groups of mice emerged. The endocrine and exocrine components of the pancreas were clearly identifiable [Figure 5a]. The exocrine component was identified by the presence of serous acini exhibiting dark staining characteristics, whereas the endocrine component consisted of dispersed islets that demonstrated lighter staining. In the control group, the pancreatic islets were observed as rounded or oval clusters of cells with clearly delineated borders, lacking surrounding membranes. These structures contained a significant quantity of islets and cells.

Figure 5: AOS facilitates the regeneration of pancreatic islets and suppresses apoptosis in pancreatic cells. (a) Pathological results of pancreas across various experimental groups (magnification ×200, scale bar: 25 µm); and (b) assessment of cell apoptosis in pancreas (magnification ×400, scale bar: 25 µm). The experiment was performed on three separate occasions. NC: Negative control, GDM: Gestational diabetes mellitus, AOS: Alginate oligosaccharides, TUNEL: Terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling, HE: Hematoxylin-eosin staining. ✶✶P < 0.01, and ✶✶✶P < 0.001.

Export to PPT

In contrast to the control group, pancreatic islet atrophy was markedly intensified in the four other experimental groups. This phenomenon was correlated with a reduction in the cellular population within the islets, an increase in the deterioration of inflammatory lesions, and vacuolar degeneration in β-cells. AOS treatment executed a restoration of pancreatic islet architecture, as evidenced by the increased number of islets and cells, reduced inflammatory lesions, and improved regeneration of pancreatic islets. However, deltamethrin treatment counteracts these effects. These observations suggest that AOS treatment may facilitate the regeneration of pancreatic islets, thereby mitigating GDM in mice; however, these beneficial effects seem to be negated by deltamethrin, which acts as an inhibitor of the Nrf2/HO-1 signaling pathway.

TUNEL assay was conducted to evaluate cellular apoptosis in the pancreas. In comparison with the control group, the other experimental groups showed a statistically significant enhancement in cell apoptosis within the pancreas (P < 0.05, [Figure 5b]). Cell apoptosis in the pancreas was remarkably diminished after AOS treatment compared with that in the GDM group (P < 0.05). However, deltamethrin can counteract this effect (P < 0.05). The GDM + deltamethrin group exhibited a notable rise in cell apoptosis (P < 0.05). Therefore, AOS inhibits cell apoptosis in pancreatic tissues, but these effects are counteracted by deltamethrin.

AOS increases insulin sensitivity and rescues islet β-cell function in GDM mice

A comparative analysis with the control group indicated that the other experimental groups exhibited significantly elevated levels of FBG, FINS, and HOMA-IR [Table 2]. The GDM + AOS and GDM + AOS + deltamethrin groups demonstrated a significant decline in FBG, FINS, and HOMA-IR levels and an increase in HOMA-β% and HOMA-ISI (all P < 0.05). By contrast, the GDM + deltamethrin group displayed an opposing trend (all P < 0.05). Hence, AOS treatment may improve not only insulin sensitivity but also β-cell function, and these effects appear to be antagonized by deltamethrin.

Table 2: AOS improves insulin sensitivity and restores islet β-cell functionality in mice with GDM.

Biochemical index NC GDM GDM+AOS GDM+AOS+Deltamethrin Deltamethrin FBG (mmol/L) 4.32±0.05 5.64±0.16 4.72±0.12 5.19±0.12 6.56±0.13 FINS (μU/mL) 10.35±0.08 21.28±0.67 14.97±0.22 17.97±0.22 23.62±0.85 HOMA-IR 2.10±0.02 5.28±0.26 3.18±0.07 5.18±0.07 6.79±0.33 HOMA-β% 392.71±39.14 232.21±18.14 326.74±41.95 256.74±41.95 172.17±6.95 HOMA-ISI −4.00±0.01 −5.02±0.05 −4.47±0.02 −4.77±0.02 −5.28±0.05 AOS alleviates IR and gluconeogenesis in the hepatic tissue of GDM mice

The mRNA levels of gluconeogenesis genes, including phosphoenolpyruvate carboxykinase (PEPCK), glucose-6-phosphatase (G-6-Pase), and glucose transporter 2 (GLUT2), were evaluated using RT-PCR. The experimental groups exhibited a significant increase in the levels of both PEPCK and G-6-Pase, while GLUT2 levels were notably diminished in comparison with the control group (P < 0.05, [Figure 6a-c]). The mRNA expression of PEPCK and G-6-Pase was decreased in GDM + AOS and GDM + AOS + deltamethrin groups while simultaneously showing an increase in GLUT2 mRNA levels (all P < 0.05) compared to the GDM groups. Conversely, the GDM + deltamethrin group exhibited an opposing trend (P < 0.05). Hence, AOS treatment may play a role in alleviating IR and inhibiting gluconeogenesis in the hepatic tissue of GDM mice. Nevertheless, the beneficial effects appear to be counteracted by deltamethrin.

Figure 6: IR and gluconeogenesis are suppressed by AOS treatment. (a) mRNA levels of PEPCK, (b) mRNA levels of G-6-Pase, and (c) mRNA levels of GLUT2 in response to the treatment of AOS, AOS + deltamethrin, and deltamethrin. The experiment was conducted on three separate occasions. NC: Negative control, GDM: Gestational diabetes mellitus, AOS: Alginate oligosaccharides, PEPCK: Phosphoenolpyruvate carboxykinase, G-6-Pase: Glucose-6-phosphatase G-6-pase, GLUT2: Glucose transporter 2. ✶P < 0.05, ✶✶P < 0.01, and ✶✶✶P < 0.001.

Export to PPT

AOS alleviates the decline in cell viability and the increase in inflammatory cytokines in normal liver cells induced by high glucose

To validate the experimental results obtained from the animal studies, we conducted experiments at the cellular level. First, we simulated the glucose-disordered environment of QSG 7701 liver cells by incubating them in high-glucose concentrations. MTT assay was utilized to evaluate cell viability subsequent to a range of treatments. The high-glucose group exhibited a remarkable decrease in cell viability compared to the low-glucose group (P < 0.05). AOS treatment (0.2 nM and 0.3 nM) increased cell viability in a concentration-dependent manner [Figure 7a]. For the subsequent experiments, a treatment concentration of 0.2 nM was chosen. We utilized deltamethrin to inhibit the Nrf2/HO-1 signaling pathway and assessed the impact of AOS on cell viability. After treatment with deltamethrin, the increase in AOS-induced cell viability was counteracted (P < 0.05, [Figure 7b]).

Figure 7: AOS alleviates the decline of cell viability and the increase in inflammatory cytokines in normal liver cells induced by high glucose. (a) Cell viability of QSG 7701 cells treated with high glucose and different concentration of AOS; (b) cell viability of QSG 7701 cells treated with high glucose, AOS, and deltamethrin; (c) cell supernatant of TNF-α, (d) IL-1β, (e) IL-6, (f) ROS production (Scale bar: 25 µm), and (g) Nrf2/ HO-1 signaling pathway activation in response to the treatment of AOS, AOS + deltamethrin, and deltamethrin. The experiment was conducted on three separate occasions. AOS: Alginate oligosaccharides, IL-6: Interleukin-6, TNF-α: Tumor necrosis factor-α, IL-1β: interleukin-1β, ROS: Reactive oxygen species, Nrf2: Nuclear respiratory factor 2, HO-1: Heme oxygenase 1.✶P < 0.05, ✶✶P < 0.01, and ✶✶✶P < 0.001.

Export to PPT

ELISA was utilized to evaluate inflammatory cytokines, including TNF-α, IL-1, and IL-1 β, subsequent to a range of treatments. The high-glucose group exhibited a significant increase in inflammatory cytokines levels in comparison with the low-glucose group (P < 0.05). AOS treatment decreased the levels of inflammatory cytokines in a concentration-dependent manner compared to the high-glucose group.

We utilized deltamethrin to inhibit the Nrf2/HO-1 signaling pathway and assessed the impact of AOS on inflammatory cytokine release. After treatment with deltamethrin, the effect of AOS on inhibiting inflammatory cytokine release was counteracted (P < 0.05, [Figure 7c-e]). Moreover, the high-glucose group exhibited a significant risen in ROS production in comparison with the low-glucose group (P < 0.05). AOS treatment reduced ROS production, and this effect was counteracted by deltamethrin (P < 0.05, [Figure 7f]). The high-glucose group also exhibited a significant decrease in the Nrf2/HO-1 signaling pathway, with nuclear Nrf2 and HO-1 expression declined (P < 0.05). AOS treatment activated the Nrf2/HO-1 signaling pathway, and this effect was counteracted by deltamethrin (P < 0.05, [Figure 7g]). The findings collectively confirm that AOS treatment improves liver cell viability and inflammation induced by high glucose. Nevertheless, the beneficial effects appear to be counteracted by deltamethrin.

SUMMARY

Patients diagnosed with GDM frequently demonstrate ongoing IR and hyperglycemia, indicating potential common etiological factors and clinical characteristics with diabetes mellitus. Given the established connection between oxidative stress and mechanisms that contribute to IR and diabetes, antioxidants may offer beneficial effects in the prevention and management of GDM. Nonetheless, effective treatment strategies are urgently needed. We explored the impacts of antioxidant supplementation (AOS) on GDM by modulating oxidative stress and the gut microbiota, which may provide valuable functional insights. Treatment with AOS can regulate oxidative stress by positively influencing the Nrf2/HO-1 signaling pathway and enhancing the gut microbiota, thereby acting as an inhibitor of GDM. AOS exerts its antioxidant effects by increasing GSH levels, modulating gene expression and signaling pathways, and neutralizing ROS that can penetrate cell membranes, thereby protecting tissues and organs. AOS significantly elevates the concentration of short-chain fatty acids, such as acetate, propionate, and butyrate, while simultaneously decreasing endotoxin levels. Furthermore, AOS can alleviate metabolic disturbances associated with a high-fat diet. It also exhibits antioxidant properties, such as enhancing wound healing in diabetic mice by neutralizing free radicals.

In the past decade, studies have underscored the significant involvement of the balance of gut microbiota in GDM progression.[17] Here, we identified that the modulation of the balance of gut microbiota by AOS may represent a viable therapeutic strategy for managing GDM. We observed that AOS effectively regulates dysbiosis in the gut microbiota, resulting in a reduction in the abundance of Gram-negative bacteria and alleviating inflammation-induced damage.[18] Notably, Gram-negative bacteria are often enriched in individuals with diabetes.[19] Following AOS treatment, a substantial reduction was observed in the prevalence of Gram-negative bacteria, specifically Proteus, Klebsiella, and Escherichia coli. Previous studies reported an increase in Marvinbryantia abundance in diabetic nephropathy, which correlates positively with serum MDA levels and intestinal mucosal inflammatory markers, consistent with the present findings.[20] In comparison with GDM mice, AOS treatment reversed the abundance of Marvinbryantia. Considering the role of gut microbiota in maintaining intestinal epithelial integrity and protecting the intestinal barrier, these results suggested that AOS treatment enhances the protective effects of the gut microbiota and mitigates the detrimental impact of hyperglycemia on vital organs.

Due to the intricate connection between glucose and lipid metabolism, the development of GDM is linked to dysregulations in lipid metabolic processes.[