Background

Global cancer statistics from the International Agency for Research on Cancer (IARC) showed 434,419 new cancer and 155,702 new cancer deaths cases with kidney in 2022.1 During the same period in 2022, there were approximately 77410 new cancer cases and 46345 new deaths from renal cancer in China.2 It is estimated that among all cancers, renal cell carcinoma will have approximately 81,610 new cases and 14,390 new deaths in the United States in 2024.3 The estimated number of deaths from renal cancer in China is very large, and the pathogenesis and treatment of renal tumors are serious challenges for researchers. Clear cell renal cell carcinoma (ccRCC) is the main types of RCC and remains an extremely lethal disease.4 The main treatment for early-stage RCC was partial nephrectomy or radical nephrectomy, while targeted drug therapy was mainly treatment for advanced renal cancer.

Tumor recurrence was still happening after nephrectomy or metastasectomy, especially for metastatic renal cell carcinoma.5 Target of tyrosine kinase inhibitor (TKI) drugs (anti-VEGF tyrosine kinase inhibitors) was the main drug treatments for metastatic ccRCC.6,7 All anti-VEGF tyrosine kinase inhibitors except sunitinib had failed to benefit to patients with locally advanced disease.8 Immune checkpoint inhibitors were used as the first-line in metastatic ccRCC. Pembrolizumab benefits patients with metastatic disease or at a high risk of recurrence as adjuvant therapy.9,10 It offered the best risk/benefit ratio, when patients took nephrectomy at high risk of relapse.11 Drug therapy inevitably develops into drug resistance and urgently needs us to study the mechanism of drug tolerance.

Previous research showed POP1 and POP4 had limited expression in prostate cancer tissue, whereas POP5 were significantly downregulated prostate cancer tissue and benign clinical samples of prostate tissue, POP1 and POP7 Expression were increased whereas POP5 were decreased by androgen.12 In this study, we investigated the gene expression of POP family and the role of POP7 in TCGA-KIRC, the expression and diagnosability of POP7 in clinical samples, GEO database, and CPTAC of ccRCC. TiMER2 and Gene Set Enrichment Analysis (GSEA) demonstrated that POP7 was a significant marker and immunosuppressor in ccRCC.

Patients and MethodsPatient Samples from Public Database and

Public database from Gene Expression Omnibus (GEO)13 (GSE16441, which contains 17 pairs of ccRCC tumours and paired normal tissues), The Cancer Genome Atlas Kidney Clear Cell Carcinoma14 (TCGA-KIRC, which contains 72 pairs of ccRCC tumours and paired normal tissues, and total 533 patients), and Office of Cancer Clinical Proteomics Research (CPTAC, which contains 110 patients).15

Clinical Samples Collection, RNA Extraction, RNA Reverse Transcription and qRT-PCR

Twenty-four clinical samples were collected from Wuhan Union Hospital between 2022 and 2023. The patient/participant provided written informed consent, and the research procedures were approved by the Institutional Review Committee of Huazhong University of Science and Technology followed by the Declaration of Helsinki. RNA extraction was then conducted using the TRizol reagent (Thermo, Massachusetts, USA). Next, synthesize the strand cDNA Synthesis with cDNA Synthesis test kit (Vazyme, Nanjing, China) and quantitative real-time polymerase chain reaction (qRT-PCR) with qPCR SYBR® Green Master Mix (Vazyme, Nanjing, China).16 Finally, we analyzed the POP7 expression with 2−ΔCt (ΔCt = Ct POP7–CtGAPDH).

POP7, (forward, 5′- CCCGGAGACCCAATGACATTT −3′,

reverse, 5′- GGGCCTTAAAGTCCGTCTTCA-3′).

GAPDH (forward, 5’-GAGTCAACGGATTTGGTCGT-3’;

reverse, 5’-GACAAGCTTCCCGTTCTCAG-3’).

Bioinformatics Analysis

Hazard ratio (HR) and confidence interval (CI) of the HR estimated the univariable and multivariable Cox proportional hazards regression. Kaplan Meier (KM) curves evaluated the patient’s survival status of OS and DFS when the survival time was cut at 120 months with surv_cutpoint and ggsurvplot in R 4.1.3. Area Under Curve (AUC) and Receiver Operator Characteristic (ROC) curve evaluated the clinical diagnostic ability of POP7 in patients with ccRCC with SPSS Statistics 22.0 and GraphPad prism 9 as described above.17

Gene set enrichment analysis (GSEA) evaluated the role of POP7 in ccRCC. (http://www.broadinstitute.org/gsea). As mentioned before, p <0.05 and false discovery rate (FDR) of <25% had statistically significant difference.18,19 TiMER2 was used to analyze the role of POP family in pan-cancer and the immune infiltration of POP7 in ccRCC.20

Statistical Analysis

RNA and protein results were described with median and SEM. The two paired and unpaired samples were analyzed with paired sample t-test or t-test, and inter multiple group analysis was analyzed in one way ANOVA as previously describe.19 Data analyses were performed with GraphPad prism 9 and followed by guidelines for reporting of statistics for clinical research in urology, *p < 0.05, ** p < 0.01,*** p < 0.001.21

ResultsThe Expression of POP Family Had a Significant Expression Difference in ccRCC

Firstly, we want to know the role of POP family in pan-cancer in Supplementary Figure 1. POP1 was significantly increased in bladder urothelial carcinoma (BLCA), breast invasive carcinoma (BRCA), cholangiocarcinoma (CHOL), colon adenocarcinoma (COAD), esophageal carcinoma (ESCA), head and neck squamous cell carcinoma (HNSC), KIRC, liver hepatocellular carcinoma (LIHC), lung adenocarcinoma (LUAD), lung squamous cell carcinoma (LUSC), prostate adenocarcinoma (PRAD), rectum adenocarcinoma (READ), stomach adenocarcinoma (STAD), and uterine corpus endometrial carcinoma (UCEC) but reduced in thyroid carcinoma (THCA) and kidney chromophobe (KICH) in Supplementary Figure 1A. POP4 was significantly increased in BLCA, BRCA, CHOL, ESCA, HNSC, KIRC, kidney renal papillary cell carcinoma (KIRP), LIHC, LUAD, LUSC, STAD, UCEC, but reduced in THCA in Supplementary Figure 1B. POP5 was significantly increased in BLCA, COAD, CHOL, ESCA, HNSC, KIRP, LIHC, LUAD, LUSC, STAD, UCEC, but reduced in KICH, KIRC, and THCA in Supplementary Figure 1C. POP7 was significantly increased in BLCA, BRCA, COAD, CHOL, ESCA, HNSC, KICH, KIRC, KIRP, LIHC, LUAD, LUSC, THCA, PRAD, STAD, UCEC in Supplementary Figure 1D. Then, we focused on the expression of this family in kidney cancer. Heat map showed the mRNA expression levels of the POP1, POP4, POP5, and POP7 in TCGA-KIRC in Figure 1A. POP1, POP4, and POP7 had a higher expression, while POP5 had a lower expression in total ccRCC tissues vs non-tumorous tissues (Normal n = 72, Tumour n = 533) in Figure 1B and C. The same results showed POP1, POP4, and POP7 had a higher expression, while POP5 had a lower expression in paired ccRCC tissues vs non-tumorous tissues (Normal n = 72, Tumour n = 72) in Figure 1D and E.

Figure 1 POP family expression in TCGA-KIRC datasets. (A) Heat map depicting POP family expression in TCGA-KIRC (n = 605). (B) and (C) POP1, POP4, and POP7 had a higher expression, while POP5 had a lower expression in paired ccRCC tissues vs non-tumorous tissues (Normal n = 72, Tumour n = 533). (D) and (E) POP1, POP4, and POP7 had a higher expression, while POP5 had a lower expression in paired ccRCC tissues vs non-tumorous tissues (Normal n = 72, Tumour n = 72). Research. ***P <0.001.

Prognostic Significance, Univariable and Multivariable Analyses in OS and DFS of POP Family in ccRCC

Next, we analyzed the prognostic significance of POP family in ccRCC. We defined the high- and low-expression groups as the median expression of POP family. The different expression of POP1 has no effect on the prognosis of ccRCC. High expression of POP4, POP5, POP7 had shorter OS and shorter DFS in Figure 2A–F. Univariable and multivariable analysis with Hazard ratio (HR) and confidence interval (CI) of the HR estimated the prognostic ability of POP7. The results of OS were showed as follows: age (HR, 1.60; 95% CI: 1.17–2.20, p = 0.003), T stage (HR, 1.54; 95% CI: 1.07–2.21, p = 0.02), N stage (HR, 2.89; 95% CI: 2.01–4.16, p < 0.0001), POP5 (HR, 1.80; 95% CI: 1.22–2.67, p = 0.003), POP7 expression (HR, 1.64; 95% CI: 1.11–2.41, p = 0.013), (Table 1). DFS: T stage (HR, 1.99; 95% CI: 1.29–3.05, p = 0.002), N stage (HR, 2.60; 95% CI: 1.23–5.48, p = 0.012), M stage (HR, 4.870; 95% CI: 3.14–7.37, p < 0.0001), Grade (HR, 2.42; 95% CI: 1.58–3.73, p < 0.000), POP7 expression (HR, 1.67; 95% CI: 3.14–7.36, p = 0.025), (Table 2). Therefore, we focus on understanding the functional role of POP 7 in ccRCC.

Table 1 Univariable and Multivariable Analyses of POP Family mRNA Level and Patient Overall Survival

Table 2 Univariable and Multivariable Analyses of POP Family mRNA Level and Patient Disease–Free Survival

Figure 2 Prognostic significance of POP family in ccRCC. (A) and (B) Higher POP 4 had shorter OS and DFS than the lower expressers. (C) and (D) Higher POP 5 had shorter OS and DFS than the lower expressers. (E) and (F) Higher POP 7 had shorter OS and DFS than the lower expressers.

Abbreviations: OS, overall survival; DFS, disease-free survival.

The Relationship Between Clinical Characteristics and POP7 in KIRC

We had analyzed the relationship of POP7 and clinical characteristics in KIRC patient, as the clinical characteristics were related to survival prognosis. POP7 expression was downregulation significantly in living patients (Figure 3A). The expression of POP7 was decreased in patients without recurrence (Figure 3B). Patients with low expression of POP7 lower tumor distant metastasis (Figure 3C), lymph node metastasis (Figure 3D). Patients with high clinical stage (T3 + T4, Figure 3E and F), higher TNM patients (III+IV, Figure 3G and H) and grade (G3 + G4, Figure 3I and J) exhibited significant high expression of POP7.

Figure 3 The relationship between clinical characteristics and POP7 in KIRC. (A) Survival status. (B) disease free status. (C) M stage. (D) N stage. (E) and (F) T stage. (G) and (H) grade. (I) and (J)TNM stage. *P <0.05, and ***P <0.001.

Verification of POP7 in ccRCC Patients

GEO data and quantitative real-time polymerase chain reaction (qRT-PCR) were used to verify POP7 expression in ccRCC patients. The results exhibited that the mRNA expression of POP7 was lower in normal tissue from GSE16441 in Figure 4A. qRT-PCR indicated mRNA expression of POP7 was lower in normal samples from ccRCC patients in Figure 4B. The mRNA expression of paired and total POP7 from CPTAC database exhibited higher in cancer samples in Figure 4C and D. Similarly, we have found that the protein expression of paired and total POP7 from CPTAC database exhibited higher in cancer samples in Figure 4E and F.

Figure 4 Verification of POP7 in ccRCC patients. (A) POP7 mRNA was higher in ccRCC cancer tissue from GSE16441. (B) POP7 mRNA was higher in ccRCC cancer samples. (C and D) The mRNA expression of paired and total POP7 exhibited higher in cancer samples from CPTAC database. (E) and (F) The protein expression of paired and total POP7 exhibited higher in cancer samples from CPTAC database. ***P <0.001.

Diagnostic Capability of POP7 in ccRCC

The diagnostic capability of POP7 with ROC curve as AUC was analyzed as the mRNA, and protein level was high in ccRCC cancer tissues. The results showed AUC was 0.8260 (95% CI: 0.7869–0.8650; p < 0.001) in total ccRCC patients with RNA expression (Figure 5A). And 0.8807 (95% CI: 0.8245–0.926; p < 0.001) in 72 paired patients with RNA expression (Figure 5B). Similar results were represented in GSE16441 (Figure 5C) and clinical samples (Figure 5D) with RNA expression. POP7 had a diagnostic capability in total (AUC = 0.9376, 95% CI: 0.9544–0.9927; p < 0.001, Figure 5E) and paired (AUC = 0.9680, 95% CI: 0.9425–0.9935; p < 0.001, Figure 5F) ccRCC patients from CPTAC database with mRNA expression. Similar results showed that POP7 had a diagnostic capability in total (AUC: 0.8594, 95% CI: 0.8092–0.9095; p < 0.001, Figure 5E) and paired (AUC = 0.8554, 95% CI: 0.8008–0.9101; p < 0.001, Figure 5F) ccRCC patients from CPTAC database in protein level.

Figure 5 The diagnostic value of POP7 in ccRCC. (A) and (B) ROC curve of POP7 mRNA between total and paired tumor and non-cancerous normal tissues in TCGA-KIRC, the AUC: 0.8260 and 0.8807 (p < 0.001); (C) The AUC of POP7 mRNA between tumor and paired non-cancerous normal tissues in GSE16441 was 0.7226 (p=0.024). (D) The AUC of POP7 mRNA between tumor and paired non-cancerous normal tissues in clinical samples was 0.6753 (p = 0.036). (E) and (F) ROC curve of POP7 mRNA between total and paired tumor and non-cancerous normal tissues in CPTAC, the AUC: 0.9376 and 0.9680 (p < 0.001). (G) and (H) ROC curve of POP7 protein between total and paired tumor and non-cancerous normal tissues in CPTAC, the AUC: 0.8594 and 0.8554 (p < 0.001).

Functional Prediction of POP7 in ccRCC

POP7 function in ccRCC was analyzed by GSEA and TiMER2. GSEA identified POP7 had a positive correlation with the downregulation of CD4+cells, CD8+cells, and natural killer (NK) cells (Figure 6A–C) but upregulation of helper T (TH1) cells (Figure 6D). In contrast, POP7 had a negative correlation with the upregulation of CD4+cells, CD8+cells, and natural killer (NK) cells (Figure 6E-H). TiMER2 results showed POP7 had a positive correlation with T cell regulatory (Tregs) and myeloid-derived suppressor cells (MDSC) in ccRCC (Figure 7A–C). On the contrary, POP7 had a negative correlation with CD4+cells, CD8+cells, and natural killer (NK) cells (Figure 7D–I). The result displayed POP7 was an immunosuppressor for ccRCC.

Figure 6 Pathway of POP7 in TCGA-KIRC with Gene Set Enrichment Analysis (GSEA). POP7 had a positive correlation with downregulation of CD4+cells (A), CD8+cells (B), natural killer (NK) cells (C). Upregulation role of POP7 in helper T (TH1) cells (D). POP7 had a negative correlation with upregulation of CD4+cells (E), CD8+cells (F and G), natural killer (NK) cells (H).

Figure 7 TiMER2 results of POP7 and immune infiltration in ccRCC. POP7 had a positive correlation with Tregs (A and B), and MDSC (C) in ccRCC. POP7 had a negative correlation with CD4+cells (D–G), CD8+cells(H), natural killer (NK) cells (I) in ccRCC.

Discussion

Previous research reported that the role of RBP had essential roles in progression and neoplasm metastasis. In clinical samples, elevated expression of an RBP, Pumilio 1 (PUM1) was associated with metastasis, recurrence, and poor survival of gastric cancer (GC). PUM1 could bind directly to DEP domain-containing mammalian target of rapamycin-interacting protein mRNA, then induce metabolic reprogramming and activate the PI3K-Akt signal in glycolysis. PUM1 deficiency could suppress glycolytic metabolism in GC.22 Circular RNAs TET2 interacted with heterogeneous nuclear ribonucleoprotein C (an RBP), which could regulate the lipid metabolism of chronic lymphocytic leukemia cell.23 Musashi-2 (MSI2, an RBP) deficiency suppressed the growth and survival and promoted ferroptosis by inactivating the MAPK signaling pathway in colorectal cancer.24 Our previous study showed that downregulation of an RBP (RNA binding protein 47) predicted low survival and could modificate RNA stability in ccRCC.25 Here, we reported the expression of an RBP family (POP family) and POP7 had a prognostic effect in ccRCC for the first time.

The role of POP family in various tumors was reported in the previous research. POP1 was up-regulated in breast cancer (BC). POP1 was one of the high-risk gene in GC.26 High expression of POP1 had a poor prognosis and more likely to be responded to immunotherapy.27 POP1 was upregulated in breast cancer (BC) tissues and cancer cell lines. High POP1 expression had poor outcomes, and POP1 overexpression promoted cell progression in BC cells.28 POP7 mRNA levels are higher in esophageal cancer (ES) tumor tissues when compared with normal tissues. Lower expression of POP7 predicted a poor prognosis in ES.29 POP5 was upregulated in the uterine corpus endometrial carcinoma cancer tumor tissue compared with normal tissues.30

In this research, we found that the expression of POP1, POP4, POP7 was significantly escalated, whereas POP5 was downregulated in ccRCC. POP7 was significantly increased in most cancer types such as BLCA, BRCA, COAD, CHOL, ESCA, HNSC, LIHC, LUAD, LUSC, THCA, PRAD, STAD, and UCEC, especially in all KICH, KIRC, and KIRP. POP7 expression was positively correlated with poor disease progression by multiple Cox proportional hazard regression methods. Patients with high POP7 expression had a poor OS and DFS, high T stage, lymphatic metastasis and distant metastasis, high grade and TNM stages. POP7 mRNA and protein had a significant role in the diagnosis of ccRCC from TCGA-KIRC, GSE16441, clinical samples, and CPTAC database.

The use of immune checkpoint inhibitors (ICIs) in cancer immunotherapy had completely changed the field of cancer treatment.31,32 ICI had improved the progress for patient care in RCC or urothelial carcinoma.33,34 CD72 was associated with Pathologic T stage, stage, M stage, N stage and tumour immunity.35 Our previous research showed LY96 was associated with immunosuppression in ccRCC.20 Nivolumab plus ipilimumab was the first-line regimen for poor-risk, intermediate-risk or metastatic RCC, and nivolumab monotherapy was used as second-line therapy.36 A review suggested that ICI-based combination therapy was the standard of care as the first-line treatment of patients with metastatic RCC even after nephrectomy, and it was critical for treatment decisions.37 The immunotherapeutic predictive role was validated in an in-house cohort.38 Patients who did not respond to treatment (primary resistance) or gradually developing into resistance to therapy (acquired resistance) posed a significant obstacle to drug treatment.39 Chemicals, toxins, and radiation were the general risk factors for cancer.40 The demand for developing new predictive and prognostic biomarkers can help mRCC patients develop personalized treatment. Then, GSEA and TiMER2 results identified POP7 had a positive correlation with TH1, Tregs cells, and MDSC, but had a negative correlation with CD4 + cells, CD8 + cells, NK cells.

Although we have achieved some research results, the functionality of POP7 has not been proven through in vitro and in vivo experiments, and the role of POP7 in tumor immunity had not been verified in vitro and in vivo experiments. We will take more research to explore the relationship between tumors and immunotherapy in the future.

Conclusion

This paper investigated the gene expression of POP family in pan-cancer, and the role of POP7 in TCGA-KIRC, POP7 was significantly correlated with cancer progression, and was an independent predictor for ccRCC. We then verified the expression and diagnosability of POP7 in clinical samples, GEO database, and CPTAC of ccRCC. The mRNA and protein of POP7 had a significant diagnosability role in ccRCC from TCGA-KIRC, GSE16441, clinical samples, and CPTAC database. GSEA and TiMER2 showed the biological role and immune infiltration of POP7 in ccRCC. This study demonstrated that POP7 was a significant marker and immunosuppressor in ccRCC.

Acknowledgments

This work was supported by grants from the National Natural Science Foundation of China (82372845), the Medjaden Academy & Research Foundation for Young Scientists (MJR202310017), and Science foundation of Wuhan Union Hospital (2022xhyn030).

Disclosure

The authors report no conflicts of interest in this work.

References

1. Bray F, Laversanne M, Sung H, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. Ca a Cancer J Clinicians. 2024;74(3):229–263. doi:10.3322/caac.21834

2. Xia C, Dong X, Li H, et al. Cancer statistics in China and United States, 2022: profiles, trends, and determinants. Chin Med J. 2022;135(5):584–590. doi:10.1097/CM9.0000000000002108

3. Siegel RL, Giaquinto AN, Jemal A. Cancer statistics, 2024. Ca a Cancer J Clinicians. 2024;74(1):12–49. doi:10.3322/caac.21820

4. Hsieh JJ, Purdue MP, Signoretti S, et al. Renal cell carcinoma. Nature Reviews Disease Primers. 2017;3(1):17009. doi:10.1038/nrdp.2017.9

5. Ishiyama Y, Omae K, Kondo T, Yoshida K, Iizuka J, Takagi T. Predicting recurrence after radical surgery for high-risk renal cell carcinoma: development and internal validation of the TOWARDS. Score Annals of Surgical Oncology. 2024;2024.

6. Chen W, Hill H, Christie A, et al. Targeting renal cell carcinoma with a HIF-2 antagonist. Nature. 2016;539(7627):112–117. doi:10.1038/nature19796

7. Cancer genome atlas research N Comprehensive molecular characterization of clear cell renal cell carcinoma. Nature. 2013;499(7456):43–49. doi:10.1038/nature12222

8. Sweeney PL, Suri Y, Basu A, Koshkin VS, Desai A. Mechanisms of tyrosine kinase inhibitor resistance in renal cell carcinoma. Cancer Drug Resist. 2023;6(4):858–873. doi:10.20517/cdr.2023.89

9. Fitzgerald KN, Motzer RJ, Lee CH. Adjuvant therapy options in renal cell carcinoma - targeting the metastatic cascade. Nat Rev Urol. 2023;20(3):179–193. doi:10.1038/s41585-022-00666-2

10. Zouein J, Naim N, Kourie HR. Adjuvant therapy in renal cell carcinoma in the immunotherapy era: where do we stand? Immunotherapy. 2023;15(2):93–100. doi:10.2217/imt-2022-0125

11. Laukhtina E, Quhal F, Mori K, et al. Pembrolizumab outperforms tyrosine kinase inhibitors as adjuvant treatment in patients with high-risk renal cell carcinoma after nephrectomy. Eur Urol Oncol. 2022;5(1):120–124. doi:10.1016/j.euo.2021.12.007

12. Romanuik TL, Ueda T, Le N, et al. Novel biomarkers for prostate cancer including noncoding transcripts. Am J Pathol. 2009;175(6):2264–2276. doi:10.2353/ajpath.2009.080868

13. Song Y, Bai G, Li X, et al. Bioinformatics analysis of human kallikrein 5 (KLK5) expression in metaplastic triple-negative breast cancer. Cancer Innov. 2023;2(5):376–390. doi:10.1002/cai2.96

14. Li W, Meng X, Yuan H, Xiao W, Zhang X. M2-polarization-related CNTNAP1 gene might be a novel immunotherapeutic target and biomarker for clear cell renal cell carcinoma. IUBMB life. 2022;74(5):391–407. doi:10.1002/iub.2596

15. Goldman M, Craft B, Swatloski T, et al. The UCSC cancer genomics browser: update 2015. Nucleic Acids Res. 2015;43(D1):D812–817. doi:10.1093/nar/gku1073

16. Meng X, Li W, Yu T, et al. Hsa_circ_0086414/transducer of ERBB2 (TOB2) axis-driven lipid elimination and tumor suppression in clear cell renal cell cancer via perilipin 3. Int J Biol Macromol. 2024;261(Pt 1):129636. doi:10.1016/j.ijbiomac.2024.129636

17. Xu N, Xiao W, Meng X, et al. Up-regulation of SLC27A2 suppresses the proliferation and invasion of renal cancer by down-regulating CDK3-mediated EMT. Cell Death Discovery. 2022;8(1):351. doi:10.1038/s41420-022-01145-8

18. Wang X, Li W, Lou N, et al. High expression of DNTTIP1 predicts poor prognosis in clear cell renal cell carcinoma. Pharmgenomics Pers Med. 2023;16:1–14. doi:10.2147/PGPM.S382843

19. Yuan H, Li W, Lou N, et al. TRPM2 facilitates tumor progression of clear cell renal cell carcinoma by relieving Endoplasmic Reticulum Stress. Int J Med Sci. 2023;20(1):57–69. doi:10.7150/ijms.77944

20. Li W, Meng X, Yu T, et al. Gene LY96 is an M2 macrophage‐related biomarker and is associated with immunosuppression in renal cell carcinoma. MedComm – Oncology. 2023;2(3). doi:10.1002/mog2.52

21. Assel M, Sjoberg D, Elders A, et al. Guidelines for reporting of statistics for clinical research in urology. Europ urol. 2019;75(3):358–367. doi:10.1016/j.eururo.2018.12.014

22. Yin S, Liu H, Zhou Z, et al. PUM1 promotes tumor progression by activating DEPTOR-meditated glycolysis in gastric cancer. Adv Sci. 2023;10(27):e2301190. doi:10.1002/advs.202301190

23. Wu Z, Zuo X, Zhang W, et al. m6A-modified circTET2 interacting with HNRNPC regulates fatty acid oxidation to promote the proliferation of chronic lymphocytic leukemia. Adv Sci. 2023;10(34):e2304895. doi:10.1002/advs.202304895

24. Meng X, Peng X, Ouyang W, et al. Musashi-2 deficiency triggers colorectal cancer ferroptosis by downregulating the MAPK signaling cascade to inhibit HSPB1 phosphorylation. Biol Proced Online. 2023;25(1):32. doi:10.1186/s12575-023-00222-1

25. Wang C, Li W, Meng X, et al. Downregulation of RNA binding protein 47 predicts low survival in patients and promotes the development of renal cell malignancies through RNA stability modification. Mol Biomed. 2023;4(1):41. doi:10.1186/s43556-023-00148-w

26. Liang C, Fan J, Liang C, Guo J. Identification and validation of a pyroptosis-related prognostic model for gastric cancer. Front Genet. 2021;12:699503. doi:10.3389/fgene.2021.699503

27. He X, Wang J, Yu H, et al. Clinical significance for diagnosis and prognosis of POP1 and its potential role in breast cancer: a comprehensive analysis based on multiple databases. Aging. 2022;14(17):6936–6956. doi:10.18632/aging.204255

28. Zhu M, Wu C, Wu X, Song G, Li M, Wang Q. POP1 promotes the progression of breast cancer through maintaining telomere integrity. Carcinogenesis. 2023;44(3):252–262. doi:10.1093/carcin/bgad017

29. Yang X, Han B, He Z, et al. RNA-binding proteins CLK1 and POP7 as biomarkers for diagnosis and prognosis of esophageal squamous cell carcinoma. Front Cell Dev Biol. 2021;9:715027. doi:10.3389/fcell.2021.715027

30. Yao Y, Liu K, Wu Y, et al. Comprehensive landscape of the functions and prognostic value of RNA binding proteins in uterine corpus endometrial carcinoma. Front Mol Biosci. 2022;9:962412. doi:10.3389/fmolb.2022.962412

31. Xiong D, Zhang L, Sun ZJ. Targeting the epigenome to reinvigorate T cells for cancer immunotherapy. Mil Med Res. 2023;10(1):59.

32. Shao J, Liu C, Wang J. Advances in research on molecular markers in immune checkpoint inhibitor-associated myocarditis. Cancer Innov. 2023;2(6):439–447. doi:10.1002/cai2.100

33. Jani Y, Jansen CS, Gerke MB, Bilen MA. Established and emerging biomarkers of immunotherapy in renal cell carcinoma. Immunotherapy. 2024;16(6):405–426. doi:10.2217/imt-2023-0267

34. Mao L, Yang M, Fan X, et al. PD-1/L1 inhibitors can improve but not replace chemotherapy for advanced urothelial carcinoma: a systematic review and network meta-analysis. Cancer Innov. 2023;2(3):191–202. doi:10.1002/cai2.75

35. Tian L, Wang Y, Zhang Z, Feng X, Xiao F, Zong M. CD72, a new immune checkpoint molecule, is a novel prognostic biomarker for kidney renal clear cell carcinoma. Eur J Med Res. 2023;28(1):531. doi:10.1186/s40001-023-01487-8

36. Grimm MO, Esteban E, Barthelemy P, et al. Tailored immunotherapy approach with nivolumab with or without nivolumab plus ipilimumab as immunotherapeutic boost in patients with metastatic renal cell carcinoma (TITAN-RCC): a multicentre, single-arm, Phase 2 trial. Lancet Oncol. 2023;24(11):1252–1265. doi:10.1016/S1470-2045(23)00449-7

37. Ghoreifi A, Vaishampayan U, Yin M, Psutka SP, Djaladat H. Immune checkpoint inhibitor therapy before nephrectomy for locally advanced and metastatic renal cell carcinoma: a review. JAMA Oncol. 2024;10(2):240–248. doi:10.1001/jamaoncol.2023.5269

38. Fan Z, Liu Y, Li C, et al. T proliferating cells derived autophagy signature associated with prognosis and immunotherapy resistance in a pan-cancer analysis. iScience. 2024;27(1):108701.

39. Roy AM, George S. Emerging resistance vs. losing response to immune check point inhibitors in renal cell carcinoma: two differing phenomena. Cancer Drug Resist. 2023;6(3):642–655. doi:10.20517/cdr.2023.47

40. Bahrami H, Tafrihi M. Global trends of cancer: the role of diet, lifestyle, and environmental factors. Cancer Innov. 2023;2(4):290–301. doi:10.1002/cai2.76