Informed consent and ethics approval

Written informed consent was obtained from the study participants as part of the Australian and China Center for Personalized Immunology Programs. The study was approved by and complies with all relevant ethical regulations of the Australian National University (ANU) and ACT Health Human Ethics Committees (ACT Health ETH.1.15.015, ANU 2015/079, ETH.1.16.011 2016/071, ETH.10.3.435 2010/409) or by the Renji Hospital Ethics Committee of Shanghai Jiaotong University School of Medicine.

Whole-exome sequencing

Participant DNA samples were enriched using the Human SureSelect XT2 All Exon V4 Kit and sequenced using the Illumina HiSeq 2000 system. Bioinformatics analysis was performed at the John Curtin School of Medical Research (JCSMR), ANU. Briefly, raw sequence reads were aligned to the human reference genome (Hg19) and single-nucleotide variants and small insertions and deletions called using the Genome Analysis Toolkit. Results were scored based on rarity as reported according to MAF, deleteriousness based on PolyPhen-2, SIFT and CADD score, expression in immune tissues and reported mouse phenotypes, as described previously18. The variant was confirmed using Sanger sequencing: TNIP1 forward 5′-TTTCGAGAGCTGAGGGATGG-3′; TNIP1 reverse, 5′-ACTCCCCAAGGTTCAAAGCTG-3′.

Human PBMC preparation

Human PBMCs were isolated using Ficoll-Paque (GE Healthcare Life Sciences) gradient centrifugation and frozen in FCS (Gibco) with 10% dimethyl sulfoxide (Sigma-Aldrich).

Mice

C57BL/6 mice were housed and bred under specific pathogen-free conditions. All mouse procedures were conducted according to regulations approved by the ANU Animal Experimentation Ethics Committee (A2022/18, A2018/38, A2021/29) under the National Health and Medical Research Council Australian code of practice. Mice used in the cellular phenotyping experiments were aged 16–20 weeks or 20–30 weeks. Both male and female mice were used. Experimental mice were randomly distributed across cages.

CRISPR–Cas9-mediated genome editing of mouse zygotes

C57BL/6Ncrl mice were housed under specific pathogen-free conditions. All mouse procedures were approved by the ANU Animal Experimentation Ethics Committee (AEEC A2014/058 and A2014/016) under the National Health and Medical Research Council Australian code of practice. TNIP1 guide RNA 5′-GAAGCAGCAGTATGAGCCAGA-3′, single-stranded oligonucleotide 5′- TTCTAACCCCAGTACCTGTCTGCCCACAGCTGCTGGAAGTGAACAAGCAGTGGGACCAGCATTTCCGGTCCATGAAGCAGCAGTATGAGCCGAAGGTGATGGAGTTCCCGGGAGCTGAGCCGAGGACGGCTCGGGGAGGCGGGCTGAGAGGCTTGTGACCTGGCTGAGATGGGGACGGTGG-3′ and Cas9 protein were obtained from Integrated DNA Technologies. The procedure for CRISPR editing of mouse zygotes, pronuclear injection and mouse genotyping has been described previously2. The primers used for genotyping and strain validation were: Tnip1Q346P forward, 5′-TCACAGTAACTCTCCAGGCC-3′; Tnip1Q346Preverse, 5′-TCCACACTTGCCTCTTCCAT-3′.

Histology

Histological analysis and scoring of microscopy imaging was carried out blinded and with deidentified genotypes. Murine salivary glands and kidneys were fixed in 10% neutral buffer formalin solution, embedded in paraffin and stained with H&E. Focal lymphocytic infiltrates in salivary gland tissue sections, defined as foci comprising 50 or more mononuclear cells, were enumerated and scored based on the following scale: 0, no infiltrates; 1, one focal infiltrate; 2, multiple focal infiltrates.

Antibodies

Antibodies for immunoblotting and the co-IP studies were as follows: mouse anti-HA (clone HA-7, cat. no. H3663, Sigma-Aldrich); rabbit anti-HA (cat. no. H6908, Sigma-Aldrich); mouse anti-FLAG M2 (cat. no. F1804, Sigma-Aldrich); mouse anti-Myc (Ab-1, clone 9E10, cat. no. OP10-200UG, Sigma-Aldrich); rabbit anti-TNIP1 (cat. no. HPA037893, Sigma-Aldrich); mouse anti-actin (clone JLA20, Developmental Studies Hybridoma Bank, University of Iowa); mouse anti-alpha-tubulin (B-5-1-2, cat. no. 32-2500, Thermo Fisher Scientific); rabbit anti-IκBα (cat. no. 9242, Cell Signaling Technology); rabbit anti-phospho IκBα (Ser32) (clone 14D4, cat. no. 2859, Cell Signaling Technology); mouse anti-SQSTM1 (cat. no. ab56416, Abcam); rabbit anti-IRAK1 (D51G7, cat. no. 4504, Cell Signaling Technology); rabbit anti-MyD88 (cat. no. 4283, Cell Signaling Technology); mouse anti-EEA1 (clone N19, cat. no. E7659, Sigma-Aldrich); rabbit anti-LAMP1 (cat. no. ab24170, Abcam); and rabbit anti-RAB7 (C-19, cat. no. sc-6563, Santa Cruz Biotechnology). Secondary antibodies were conjugated to horseradish peroxidase (HRP) (mouse anti-rabbit IgG peroxidase conjugated, light chain specific, cat. no. 211-032-171, Jackson ImmunoResearch) used at 1:2,500 dilution, goat anti-mouse IgG peroxidase conjugated, light chain specific (cat. no. 115-035-174, Jackson ImmunoResearch) used at 1:2,500 dilution, goat anti-mouse IgG, HRP-conjugated (cat. no. 62-6520, Thermo Fisher Scientific) used at 1:5,000 dilution, goat anti-rabbit IgG, HRP-conjugated (cat. no. 65-6120, Thermo Fisher Scientific) and Alexa Fluor 568 or Alexa Fluor 488 (Invitrogen Molecular Probes). For IP, 2 μg of primary antibodies were used. Antibodies used for immunofluorescence imaging included: mouse anti-HA used at 1:300 dilution; rabbit anti-HA used at 1:300 dilution; mouse anti-FLAG M2 used at 1:200 dilution; mouse anti-myc (Ab-1) used at 1:150 dilution; rabbit anti-TNIP1 used at 1:100 dilution; mouse anti-SQSTM1 used at 1:100 dilution; rabbit anti-IRAK1 used at 1:100 dilution; rabbit anti-MyD88 used at 1:100 dilution; mouse anti-EEA1 used at 1:100 dilution; rabbit anti-LAMP1 used at 1:100 dilution; and goat anti-RAB7 used at 1:100 dilution. Secondary antibodies conjugated to Alexa Fluor 568, 594 or 488 were all used at 1:500 dilution (donkey anti-goat IgG Alexa Fluor 488, cat. no. A-11055, Invitrogen; donkey anti-rabbit IgG, Alexa Fluor 488, cat. no. A-21206, Invitrogen; donkey anti-mouse IgG Alexa Fluor 488, cat. no. A21202, Invitrogen; Alexa Fluor 568 donkey anti-mouse IgG, cat. no. A10037, Invitrogen; donkey anti-rabbit IgG, Alexa Fluor 594, cat. no. A-21207). The antibodies and dyes used for staining mouse tissues for flow cytometry include: annexin V-FITC (1:100 dilution, cat. no. 560931, BD Pharmingen); B220-Alexa Fluor 647 (1:400 dilution, clone RA3-6B2, cat. no. 557683, BD Pharmingen); B220-BUV395 (1:200 dilution, clone RA3-6B2, cat. no. 563793, BD Horizon); B220-BUV737 (1:200 dilution, clone RA3-6B2, cat. no. 612838, BD Horizon); BCL6-A467 (1:40 dilution, clone K112-91, cat. no. 561525, BD Pharmingen); BST2-PE (1:400 dilution, clone 927, cat. no. 127010, BioLegend); CCR7-PerCP-Cy5.5 (1:50 dilution, clone 4B12, cat. no. 120116, BioLegend); CD3 Alexa Fluor 700 (1:200 dilution, clone 17A2, cat. no. 100216, BioLegend); CD4 Alexa Fluor 647 (1:400 dilution, clone RM4-5, cat. no. 100530, BioLegend); CD4 BUV395 (1:200 dilution, clone 6K1.5, cat. no. 563552, BD Horizon); CD4 PerCP-Cy5.5 (1:400 dilution, clone RM4-5, cat. no. 116012, BioLegend); CD8-BUV805 (1:200 dilution, clone 53-6.7, cat. no. 612898, BD Horizon); CD11b-PerCP-Cy5.5 (1:400 dilution, clone M1/70, cat. no. 101228, BioLegend); CD11c-Alexa Fluor 647 (1:200 dilution, clone N418, cat. no. 117312, BioLegend); CD11c-BV510 (1:400 dilution, clone N418, cat. no. 117353, BioLegend); CD11c-FITC (1:800 dilution, clone N418, cat. no. 117305, BioLegend); CD19 Alexa Fluor 700 (1:200 dilution, clone eBio1D3, cat. no. 56-0193-82, Invitrogen); CD19-BV605 (1:400 dilution, clone 6D5, cat. no. 115540, BioLegend); CD19-BUV395 (1:200 dilution, clone 1D3, cat. no. 563557, BD Horizon); CD21/35-BV605 (clone 7G6, 1:400 dilution, BD Horizon); CD23-BV421 (1:400 dilution, clone B3B4, BioLegend); CD25-APC (1:200 dilution, clone PC61, cat. no. 102012, BioLegend); CD25-PE (1:100 dilution, clone PC62, BioLegend); CD44-FITC (1:50 dilution, clone IM7, cat. no. 563176, BD Pharmingen); CD44-Pacific Blue (1:400 dilution, clone IM7, cat. no. 103020, BioLegend); CD45.2-PerCP-Cy5.5 (1:200 dilution, clone 104, cat. no. 552950, BD Biosciences); CD45.1-BV605 (1:100 dilution, clone A20, cat. no. 110737, BioLegend); CD45.1-BV711 (1:200 dilution, clone A20, cat. no. 110739, BioLegend); CD95 (FAS)-BV510 (1:200 dilution, clone Jo2, cat. no. 563646, BD Horizon); CD98-PE-Cy7 (1:200 dilution, clone RI.388, cat. no. 128214, BioLegend); CD138-PE (1:400 dilution, clone 281-2, cat. no. 561070, BD Pharmingen); CXCR3-PE (1:400 dilution, clone CXCR3-173, cat. no. 126506, BioLegend); CXCR5-Biotin (1:40 dilution, clone 2G8, cat. no. 551960, BD Biosciences); FOXP3-FITC (1:200 dilution, clone FJK-16s, cat. no. 11-5773-82, eBioscience); FOXP3-PE-Cy7 (1:400 dilution, clone FJK-16s, cat. no. 25-5773-82, eBioscience); IA/IE-BV421 (1:800 dilution, clone M5/114.15.2, cat. no. 107631, BioLegend); IgD-PerCP-Cy5.5 (1:400 dilution, clone 11-26c.2a, cat. no. 564273, BD Pharmingen); IgD-PE (1:800 dilution, clone 11-26c.2a, cat. no. 405705, BioLegend); IgM-FITC (1:200 dilution, clone II/41, cat. no. 553437, BD Pharmingen); IgM-PE-Cy7 (1:400 dilution, clone II/41, cat. no. 25-5790-82, Invitrogen); PD1-BV421 (1:200 dilution, clone 29F.1A12, cat. no. 135217, BioLegend); Ly6C-Biotin (1:200 dilution, clone AL-21, cat. no. 557359, BD Pharmingen); Ly6G-FITC (1:200 dilution, cat. no. 127606, BioLegend); SiglecH-APC (1:200 dilution, clone 551, cat. no. 129611, BioLegend); streptavidin-BV510 (1:400 dilution, cat. no. 405233, BioLegend); streptavidin-PE-Cy7 (1:400 dilution, cat. no. 25-4317-82, eBioscience); LIVE/DEAD APC-Cy7 (eFluor 780) (1:1,000 dilution, cat. no. 65-0865-18, eBioscience); LIVE/DEAD Fixable Aqua Dead Cell Stain (1:1,000 dilution, cat. no. L34957, Invitrogen); Fc Block CD16/CD32 (1:100 dilution, clone 2.462, cat. no. 553141, BD Pharmingen); and Cell Trace Violet (manufacturer’s recommendations, cat. no. C34557, Molecular Probes). Antibodies used to stain human PBMCs include: CD11c-BUV395 (1:50 dilution, clone B-ly6, cat. no. 563787, BD Biosciences); CD11c-BV510 (1:25 dilution, clone B-ly6, cat. no. 563026, BD Biosciences); CD127-BB700 (1:25 dilution, clone HIL-7R-M21, cat. no. 566398, BD Biosciences); CD19 APC-Cy7 (1:50 dilution, clone SJ25C1, cat. no. 348794, BD Biosciences); CD19-BV650 (1:50 dilution, clone HIB19, cat. no. 302238, BioLegend); CD24-BV605 (1:25 dilution, clone ML5, cat. no. 311124, BioLegend); CD24-BV711 (1:50 dilution, clone ML5, cat. no. 563401, BD Biosciences); CD25-APC-R700 (1:50 dilution, clone 2A3, cat. no. 565106, BD Biosciences); CD27-PE-Cy7(1:20 dilution, clone M-T271, cat. no. 560609, BD Biosciences); CD27-APC-eFluor780 (1:50 dilution, clone O323, cat. no. 47-0279, eBiosciences); CD38-APC (1:20 dilution, clone HB-7, cat. no. 345807, BD Biosciences); CD38-BV605 (1:25 dilution, clone HIT2, cat. no. 303532, BioLegend); CD3-BV786 (1:200 dilution, clone SK7, cat. no. 563799, BD Biosciences); CD3-FITC (1:50 dilution, clone UCHT1, cat. no. 300406, BioLegend); CD45RA-PE-Cy7 (1:50 dilution, clone HI100, cat. no. 25-0458-73, eBioscience); CD45RA-Pacific Blue (1:100 dilution, clone HI100, cat. no. 304123, BioLegend); CD4-BUV496 (1:100 dilution, clone SK3, cat. no. 564651, BD Biosciences); CD56-BUV737 (1:400 dilution, clone NCAM16.2, cat. no. 564447, BD Pharmingen); CD8-BV421 (1:100 dilution, clone RPA-T8, cat. no. 562428, BD Biosciences); CXCR3-PE (1:50 dilution, clone G025H7, cat. no. 353706, BioLegend); CXCR5-Alexa Fluor 647 (1:50 dilution, clone RF8B2, cat. no. 558113, BD Biosciences); IgD-BV421 (1:50 dilution, clone IA6-2, cat. no. 562518, BD Biosciences); IgD-BV510 (1:30 dilution, clone IA6-2, cat. no. 348220, BioLegend); LIVE/DEAD Fixable Blue Dead Cell Stain (1:1,000 dilution, cat. no. L23105, Invitrogen); LIVE/DEAD Stain Kit Green Fluorescent (1:1,000 dilution, cat. no. L23101, Invitrogen); and PD1-PE-CF594 (1:50 dilution, clone EH12.2H7, cat. no. 329940, BioLegend). All fluorescence-activated cell sorting and microscopy work was carried out at the Microscopy and Cytometry Facility, ANU.

Flow cytometry

Murine spleens were isolated as single-cell suspensions after red blood cell lysis. To stain for surface markers, cells were incubated for 30 min at 4 °C in antibody mixture diluted in ice-cold staining buffer (2 mM EDTA, 2% FCS in PBS). Before addition of the antibody staining cocktails, purified rat anti-mouse CD16/CD32 (Mouse BD Fc Block, BD Biosciences) was used to block Fc receptors; Zombie aqua dye (BioLegend) or anti-Fixable Viability Dye-eFluor780 (eBioscience) was used to stain dead cells. To stain intracellular markers, the Foxp3 Transcription Factor Staining Buffer Set (eBioscience) was used according to the manufacturer’s instructions. A Fortessa or LSRFortessa X-20 cytometer with FACSDiva software (BD Biosciences) were used for flow cytometry acquisition; data were analyzed using FlowJo (FlowJo LLC)

Generation of bone marrow chimeras

Rag1−/− recipient mice were irradiated (500 cGy) and intravenously injected with equal numbers of BM cells (2 × 106) from either WT or vikala CD45.2 and WT CD45.1 donor mice. CD45.1 donors were C57BL/6-Ptprca mice. Bactrim was administered to the drinking water provided to mice 48 h prior to injection and for 6 weeks following injection. 16 weeks post-reconstitution mice were euthanised and spleens harvested for flow cytometric phenotyping.

Generation of particulate immune complexes and B cell stimulations

Particulate immune complexes of anti-BCR (Biotin-SP AffiniPure Fab Fragment Goat Anti-Mouse IgM, μ-chain-specific, cat. no. 115-067-02015-067-020, Jackson ImmunoResearch), CpG-B (ODN 1826 Biotin, cat. no. tlrl-1826b, Invivogen) and anti-BCR-CpG for enhanced in vitro stimulation of splenocytes were generated by conjugation of ligands to streptavidin-coated 0.196-μm microspheres (cat. no. CP01001, Bangs Laboratories) as described previously44. Splenocytes were negatively magnetic-activated cell-sorted for B cells and stained with Cell Trace Violet (cat. no. C34557, Molecular Probes) at a concentration of 10 μM in PBS warmed to 37 °C for 10 min. Samples were diluted with 10 ml cold complete Roswell Park Memorial Institute (RPMI) 1640 medium and rested on ice for 5 min before centrifugation and resuspension of the pellet. A total of 2 × 105 of these B cells were incubated with 5,000× conjugated microspheres for each of the stimulation conditions for 72 h in complete RPMI 1640 medium before staining with fluorochrome-conjugated antibodies for analysis using flow cytometry.

Cytokine analysis

Analysis of the cytokines secreted by pDCs were determined using a multiplex ELISA for interleukin-1β, TNFα, KC and interleukin-6 (MCYTOMAG-70K, Merck Millipore), and an IFNβ ELISA (MECY2MAG-73K, Merck Millipore) according to the manufacturer’s instructions. Cytokine quantification was performed on a MAGPIX (Luminex) analyzer and data were collected using xPONENT v.4.2.

Mesoscale

Mesoscale was performed according to the manufacturer’s guidelines using the Mouse Isotyping Panel 1 Kit (cat. no. K15183B, Meso Scale Discovery) for IgA, IgG1, IgG2a, IgG2b, IgG3 and IgM. Serum was diluted 1:100,000 in 1% FCS in PBS; 0.05% PBS-Tween 20 was used for all wash steps.

BMDM and B cell cultures

Primary BMDMs were cultured for 5 days in DMEM (Gibco) supplemented with 1% nonessential amino acids (Gibco), 10% FCS, 30% medium conditioned by L929 mouse fibroblasts and 1% penicillin-streptomycin. BMDMs were seeded onto 12-well plates at a density of 1 × 106 cells per well, followed by overnight incubation. Cells were treated with LPS (100 ng μl−1) alone or in combination with bafilomycin A1 (100 nM) (Selleckchem) for 2 h after treatment with TLR agonists; cells were collected and either lysed in 100 μL radioimmunoprecipitation assay buffer for immunoblotting or 1 ml TRIzol for quantitative PCR.

Splenocytes from mice were MACS-sorted using a Pan B Cell Isolation Kit II (cat. no. 130-104-443, Miltenyi Biotec); 1 × 106 cells per well were plated before stimulation for the indicated time points with CpG-B (100 nM, cat. no. tlr1-1826-1, InvivoGen), R848 (2 μg ml−1, cat. no. tlrl-r848, InvivoGen), AffiniPure F(ab')2 Fragment Goat Anti-mouse IgM, μ-chain-specific (10 μg ml−1, cat. no. 115-006-075, Jackson ImmunoResearch), recombinant mouse BAFF (25 ng ml−1, cat. no. 591202, BioLegend) and CD40 monoclonal antibody (1C10) (20 μg ml−1, cat. no. 16-0401-82, Thermo Fisher Scientific).

BM-derived pDC culture

BM cells isolated from mice femur and tibia were cultured in T25 flasks for 10 days (37 °C in 5% CO2) in RPMI 1640 (cat. no. 11875093, Thermo Fisher Scientific) supplemented with 10% FCS (cat. no. F8192, Sigma-Aldrich), 2 mM L-glutamine (cat. no. 25030081, Thermo Fisher Scientific), 100 U ml−1 penicillin-streptomycin (cat. no. 15140163, Thermo Fisher Scientific), 2.5 mM, pH 7.2–7.5, pKa 7.3 at 37 °C (cat. no. 15630130, Thermo Fisher Scientific), 1 mM sodium pyruvate (cat. no. 11360070, Thermo Fisher Scientific) and 300 ng ml−1 of mouse Flt3 ligand (cat. no. 130-097-372, Miltenyi Biotec) to promote pDC differentiation. pDCs were seeded onto 96-well plates (150,000 cells per well) and rested for 2 h before stimulation with CpG-A (1 µM, cat. no. tlr-1585, InvivoGen), R837 (1 µg ml−1, cat. no. tlr-imq, InvivoGen) or R848 (1 µg ml−1, cat. no. tlrl-r848, InvivoGen) or infection with E. coli at a multiplicity of infection of 50 for 6–12 h. After stimulation, the 96-well plates were centrifuged at 1,000g for 5 min to pellet the pDCs. The supernatant was collected for cytokine analysis. For the in vitro experiments, 2–4 cell replicates were randomly allocated to the wells of tissue culture plates and treated with the indicated experimental conditions or stimuli.

HEp-2 immunofluorescence

Antinuclear antibodies were determined using HEp-2 slides (NOVA Lite). Serum was diluted 1:40 before addition to the HEp-2 slides and stained using donkey anti-mouse IgG Alexa Fluor 488 secondary antibody at 1:5,000 dilution. Imaging of the slides was performed using an Olympus IX71 inverted fluorescence microscope with an Olympus UPlanSApo 20× objective.

ELISAs for anti-DNA antibody detection

Ninety-six-well plates (SANTSC-204463) were coated with poly-l-lysine (cat. no. P8920, Sigma-Aldrich) and incubated at 22–24 °C for 5 h before the addition of 50 ng of calf thymus DNA (cat. no. D7290, Sigma-Aldrich) diluted in ELISA coating buffer (0.05 M sodium carbonate anhydrous/sodium hydrogen carbonate, pH 9.6) overnight. Plates were blocked in PBS and 1% BSA blocking buffer for 2 h at 22–24 °C. Mouse serum was diluted 1:40 with blocking buffer and incubated overnight at 4 °C. The plates were washed (PBS and 0.05% Tween 20), and goat anti-mouse IgG-AP antibodies (cat. no. 1030-04, Southern Biotech) were added for 1 h at 37 °C. Phosphatase substrate (cat. no. S0942, Sigma-Aldrich) diluted (1 mg ml−1) in ELISA developing buffer (0.1 M glycine, 0.1 mM ZnCl2, 1.0 M MgCl2·6H2O, pH 10.4) was added to the plate. The absorbance of the samples was measured at 405 nm and normalized to background absorbance at 605 nm using the Infinite 200 PRO Tecan Microplate Reader (Tecan).

ELISAs for murine IgG and IgG2c quantification

Ninety-six-well plates were coated with goat anti-mouse kappa (Southern Biotech cat. no. 1050-01) in ELISA coating buffer, and incubated at 22–24 °C overnight at 4 °C. Plates were blocked in PBS and 3% BSA blocking buffer for 1 h at 37 °C. The plates were washed (PBS and 0.05% Tween 20). Mouse serum was diluted 1:500 (IgG assay) or fourfold from 1:100 to 1:409,6001 (IgG2c assay) in 3% BSA blocking buffer, added to the plate and incubated for 1 h at 37 °C. The plates were washed and goat anti-mouse IgG-AP or goat anti-mouse IgG2c-AP (cat. no. 1079-04, Southern Biotech) was added; the plates were incubated for 1 h at 37 °C. The plates were washed and phosphatase substrate diluted (1 mg ml−1) in ELISA developing buffer was added and incubated for 1 h or up to 3 h at 37 °C. The absorbance of samples was measured at 405 nm and normalized to background absorbance at 630 nm using the Infinite 200 PRO Tecan Microplate Reader. The total serum IgG concentration was determined using a standard curve generated using optical density readouts from a serially diluted IgG1 isotype control (cat. no. 02-6100, Thermo Fisher Scientific).

Microbial culture

E. coli (strain no. 11775, American Type Culture Collection) containing the relevant plasmid constructs was grown in Luria-Bertani medium (cat. no. 244620, BD) overnight under aerobic conditions at 37 °C. Overnight cultures were used to extract plasmid DNA using mini or midi plasmid extraction kits (QIAGEN).

Expression vectors and mutagenesis

The following expression vectors were obtained: untagged TBK1 (cat. no. SC11125, Origene Technologies); HA-TNIP1 (cat. no. HG14942-NY, Sino Biological); untagged IRF5 (cat. no. SC104269, OriGene Technologies), untagged MyD88 (cat. no. OHu21475, GenScript); pNIFTY (NF-κB luciferase vector, InvivoGen); IFNβ luciferase (a gift from J. P.-Y. Ting, Department of Microbiology-Immunology, Lineberger Comprehensive Cancer Center, University of North Carolina); pRL-CMV (Promega Corporation); ATG7 (pCMV-myc-Atg7, plasmid no. 24921, Addgene); IRAK1 (cat. no. OHu18911C, GenScript);, TAX1BP1 (a gift from M. Cook, Department of Medicine, University of Cambridge); FLAG-TRAF6 (plasmid no. 66929, Addgene); and A20 (cat. no. HG12089-NF, Sino Biological). Mutagenesis was performed using the Quikchange I and II site-directed mutagenesis protocols (Agilent Technologies). The mutagenesis primer sequences used to generate the TNIP1 variants were: 5′-GAAGCAGCAGTATGAGCCGAAGATCACTGAGCTGC-3′ (Q333P); and 5′-GAAGATCTTCGAGGAGAACTTCCAGAGGGAGCG-3′ (D472N). Sanger sequencing of the samples was performed using the following primers 5′-GAAGATGCTGGAGCAGCAGC-3′ and 5′-GACAGCAGAGGCCAAGGAGC-3′ for Q333P and D472N, respectively, by the Australian Cancer Research Foundation Biomolecular Resource Facility, JCSMR and ANU.

Transfection, IP and immunoblotting

HEK 293 or HEK 293T cells (cat. no. CRL-3216, ATCC, Invitro Technologies) were transfected (Lipofectamine 2000, Thermo Fisher Scientific) with the relevant plasmids according to the manufacturer’s recommendations. Whole-cell extracts were prepared from HEK 293 or stimulated B cells or pDCs were lysed in radioimmunoprecipitation assay buffer (1% Triton X-100, 50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 0.5% sodium deoxycholate, 0.1% SDS) and centrifuged. The indicated proteins were immunoprecipitated with specific antibody using Protein G Agarose (cat. no. 16-266, Merck Millipore). Immunoprecipitants or whole-cell extracts were resuspended in SDS buffer and boiled before electrophoresis on denaturing SDS–polyacrylamide gel electrophoresis gels. Gels were transferred to nitrocellulose membranes (cat. no. 1620097, Bio-Rad Laboratories), blocked overnight (tris-buffered saline with 01% Tween 20 and skimmed milk) and probed with the relevant primary and secondary antibodies; rabbit anti-TNIP1 (cat. no. HPA037891, Sigma-Aldrich) used at 1:1000 dilution; mouse anti-actin used at 1:5,000 dilution; rabbit anti-IRAK1 used at 1:1,000 dilution; rabbit anti-MyD88 used at 1:1,000 dilution; mouse anti-alpha-tubulin used at 1:5,000 dilution; rabbit anti-IκBα used at 1:1,000 dilution; rabbit anti-phospho IκBα (Ser32) used at 1:1,000 dilution; mouse anti-rabbit IgG peroxidase conjugated, light chain specific used at 1:2,500 dilution; goat anti-mouse IgG peroxidase conjugated, light chain specific used at 1:2,500 dilution; goat anti-mouse IgG (H+L), HRP-conjugated used at 1:5,000 dilution; and goat anti-rabbit IgG (H+L) HRP-conjugated. Membranes were developed with enhanced chemiluminescence developer (Clarity Western ECL Substrate, cat. no. 170-5061, Bio-Rad Laboratories).

Dual luciferase assays

HEK 293 cells (sourced from ATCC, cat. no. CRL-1573, Invitro Technologies; Mycoplasma-tested using the PlasmoTest (cat. no. rep-pt1, InvivoGen) were transfected with either an IFNβ reporter (145 ng) (a gift from J. P.-Y. Ting) containing a 130-bp region from the IFNB gene or the pNIFTY (45 ng) reporter plasmid comprising five NF-κB repeated transcription factor binding sites upstream of an ELAM proximal promoter to drive the expression of a firefly luciferase reporter gene. pRL-CMV (5 ng) constitutively expressing Renilla, was included as a transfection control with pcDNA3.1 and the indicated vectors. Cells were lysed 24 h after transfection and dual luciferase assays were performed in accordance with the manufacturer’s guidelines (Luc-Pair Duo-Luciferase HS Assay Kit, GeneCopoeia).

Immunofluorescence staining and microscopy

Cells that adhered to coverslips were transfected with tagged constructs, fixed in 3.7% formaldehyde, then permeabilized and blocked with 5% BSA/0.1% Triton X-100 for 1 h. Staining with specific primary antibodies was carried out in blocking buffer for 1 h. Antibodies used include: mouse anti-HA used at a 1:300 dilution; rabbit anti-HA used at a 1:300 dilution; mouse anti-FLAG M2 used at a 1:200 dilution; mouse anti-myc (Ab-1) used at a 1:150 dilution; rabbit anti-TNIP1 used at a 1:100 dilution; mouse anti-SQSTM1 used at a 1:100 dilution; rabbit anti-IRAK1 used at a 1:100 dilution; rabbit anti-MyD88 used at 1:100 dilution; mouse anti-EEA1 used at a 1:100 dilution; rabbit anti-LAMP1 used at a 1:100 dilution; and goat anti-RAB7 used at a 1:100 dilution. Secondary antibodies conjugated to Alexa Fluor 568, 594 or 488 were all used at a 1:500 dilution (donkey anti-goat IgG Alexa Fluor 488; donkey anti-rabbit IgG, Alexa Fluor 488; donkey anti-mouse IgG Alexa Fluor 488; Alexa Fluor 568 donkey anti-mouse IgG; and donkey anti-rabbit IgG, Alexa Fluor 594). Cells were washed in PBS with 0.1% Tween 20 and stained with appropriate Alexa Fluor-labeled secondary antibodies before mounting in VECTASHIELD (Vector Laboratories) with DAPI. Images were captured on an Olympus IX71 inverted microscope using an Olympus PlanApo N 60× oil objective (1.42 numerical aperture/0.17 working distance) or PlanApo N 100× oil objective (1.40 numerical aperture/0.17 working distance). Transfected cells were stained with MTDR FM by diluting the stock solution in growth medium and adding to cells growing on coverslips to a final concentration of 500 nM. After incubation for 30 min at 37 °C, cells were fixed in 3.7% formaldehyde and mounted in VECTASHIELD with DAPI. Images were captured on a Leica SP5 confocal microscope with a pin hole of 95.5 μm and a HCX PL APO lambda blue 63× 1.4 oil objective, and compiled using Adobe Photoshop. Particle sizes were quantified using Fiji45.

Structural modeling

As no crystal structure was available for residues 292–389, a computer model of the location of the variant within the TNIP1 structure was designed using AlphaFold predictions (AF-Q15025-F1) and modeled in PyMOL. Residues 292–389, including the TNIP1Q333P variant, were submitted to ColabFold v.1.5.2 and AlphaFold2 using MMseqs2 (ref. 46). The highest confidence structure produced was represented in PyMOL.

Statistical analysis

All statistical analyses were carried out using Prism v.9 (GraphPad Software). Statistically significant differences are indicated as P ≤ 0.05. Statistical significance was assessed on log-transformed cellular phenotyping, ELISA and Meso Scale datasets using a one-way ANOVA with post-hoc Tukey test to compare multiple treatments. A two-way ANOVA was used for the BM chimera cellular phenotyping dataset; a two-way ANOVA with a Šidák multiple-comparisons test was used for the BM-derived pDC cytokine analysis. All data were filed using Microsoft Excel and graphed using Prism. No animals or data points were excluded from the analyses. Data distribution was assumed to be normal but this was not formally tested. Aside from the histological analysis of salivary gland and kidney sections, data collection and analysis were not performed blind to the conditions of the experiments. No statistical methods were used to predetermine sample sizes but our sample sizes are similar to those reported in previous publications2.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.