Animals

All animal procedures complied with the animal care standards set forth by the US National Institutes of Health and were approved by the Institutional Animal Care and Use Committee of the Institute of Neuroscience, Center for Excellence in Brain Science and Intelligence Technology, Chinese Academy of Sciences, and Peking University. Mice were kept on a C57BL/6 background and housed in cages containing corn bedding under a 12 h light-ON, 12 h light-OFF cycle, with food and water provided at libitum from the cage lid.

Ccr2 knockout mice (Ccr2 KO; B6.129S4-Ccr2tm1lfc/J; JAX strain 004999 | Ccr2 KO) [55] on C57BL/6 background were obtained from the JAX laboratory. The P14 group consisted of P14-P15 mice, both male and female mice were used. The number of mice used in each experiment is indicated in figure legends.

Primary dissociated hippocampal cultures were prepared from P0 pups of Sprague-Dawley rats or mice on C57BL/6 background.

Drugs Treatment

For treatment with CCL2, recombinant rat CCL2 (CCL2 (R&D, 3144-JE-050/CF) mouse CCL2 (R&D, 479-JE-050/CF) or human CCL2 (R&D, 279-MC-050/CF) was added, according to the origin of the cell type used; control was an equal amount of BSA (vehicle, R&D, RB02, 0.1% Bovine Serum Albumin in PBS, the dissolvent of CCL2). For lipopolysaccharides (LPS, Escherichia coli, serotype O111:B4, Sigma, Cat# L2630-25MG; 10 mg/kg) experiments, mice were intraperitoneally (i.p.) injected with a single dose of LPS, while littermate control animals received the same volume of saline (SA); mice were sacrificed 2 h post-injection.

DNA Constructs

All DNA constructs encode vertebrate proteins expressed under the CAG promoter. pPiggyBac-hCCR2-P2A-mCherry was generated by subcloning hCCR2 from CCR2-Tango (a gift from Prof. Bryan L Roth, University of North Carolina, USA; Addgene: CCR2-Tango, RRID: Addgene_66239) into pPiggyBac-MRGPRX4-P2A-mCherry [56], replacing MRGPRX4 with hCCR2. SEP-GluA1, GluA2, and DsRed2 (gifts from Prof. Yong Zhang, Peking University) [57], and Nano-Luciferase [56] were as previously described. SEP-GluA1 consists of a pH-sensitive form of GFP (Super Ecliptic pHluorin, SEP) fused to the N-terminal regions of GluA1; SEP fluorescence is quenched in vesicles (low pH) and thus its fluorescence reflects the level of surface GluA1 expression.

Real-Time Quantitative PCR (RT-qPCR)

RT-qPCR was carried out as described previously [35]. Briefly, total RNA was extracted from tissue (whole hippocampus) using TRIzol reagent (Invitrogen, 15596018). First-strand cDNA was generated using the M-MLV reverse transcriptase (Promega, M1701) according to the manufacturer’s protocols. RT-qPCR was performed using SYBR Green Master Mix (TaKaRa, RR420A) on LightCycler 480 (Roche Applied Science). All reactions were carried out in duplicates, and the comparative CT method was used. Primers used for RT-qPCR were as follows: Ccl2-F: CCGGCTGGAGCATCCACGTGT, Ccl2-R: TGGGGTCAGCACAGACCTCTCTCT; Tnfα-F: GACCCTCACACTCAGATCATCTTCT, Tnfα-R: CCTCCACTTGGTGGTTTGCT; Il-1β-F: CTCCATGAGCTTTGTACAAGG, Il-1β-R: TGCTGATGTACCAGTTGGGG; Il-6-F: ACACATGTTCTCTGGGAAATC, Il-6-R: AGTGCATCATCGTTGTTCATA; Gria1-F: CGAGTTCTGCTACAAATCCCG, Gria1-R: TGTCCGTATGGCTTCATTGATG; Gria2-F: AAAGAATACCCTGGAGCACAC, Gria2-R: CCAAACAATCTCCTGCATTTCC; Gapdh-F: CTGCCCAGAACATCATCCCT, Gapdh-R: TGAAGTCGCAGGAGACAACC.

Fluo-8 Gαq-fluorescence Assay

A stable HEK293T cell line expressing pPiggyBac-hCCR2-P2A-mCherry was generated by transfecting the construct together with hyperactive PiggyBac transposase [58] and adding puromycin (1 mg/ml), using standard protocol [56]. The stable pPiggyBac-hCCR2-P2A-mCherry HEK293T was then reseeded in 96-well plates at a density of ~ 50,000 cells per well. The next day, cells were loaded with the Fluo-8, AM (4 μM, AAT Bioquest, 21083) for 1 h. The effects of recombinant human CCL2 and BSA (vehicle) were measured using the FLIPR TETRA system (PerkinElmer). Two independent cultures, each with 3 samples per condition were assayed.

Gαs-luciferase Assay

HEK293T cells were seeded in 6-well plates; at a confluency of 80%, Nano-Luciferase [56] with/without pPiggyBac-hCCR2-P2A-mCherry were transfected using PEI MAX (Polysciences, 24765-100). One day later, cells were digested and reseeded in 96-well plates at a density of ~ 50,000 cells per well. Fresh culture medium containing forskolin (10 µmol/L), recombinant human CCL2, or BSA (vehicle) was added. Plates were incubated at 37 °C in 5% CO2 for 24 h, then 10 µL of culture medium from each well was mixed with 40 µL fresh culture medium and 50 µL assay buffer (containing coelenterazine, 20 µmol/L); after a further 5 min of incubation, luminescence was measured using EnVision plate reader (PerkinElmer). Three independent cultures, each with 3 samples per condition were assayed.

Hippocampal Neuronal Culture and Transfection

Hippocampal neuron-glia co-cultures were prepared as previously described [59,60,61,62]. Briefly, primary hippocampal neuronal cultures were prepared from postnatal day 0 (P0) pups of Sprague-Dawley rats or mice on C57BL/6 background (males and females, randomly selected); hippocampi were dissected out, and dentate gyri were removed. ~ 120,000 cells were plated on Poly-D-lysine hydrobromide (PDL, Sigma, P7280) -coated 12 mm glass coverslips (Assistant, 01105209, Sondheim, Germany) in 24-well plates, or 35 mm glass bottom μ-Dishes (Ibidi, 81158, Martinsried, Germany). Culture medium contained Neurobasal medium (GIBCO, 10888022), B-27 (Invitrogen, 17504-044), 2 mmol/L Glutamax-I (Invitrogen, 35050061), and 2.5% FBS (HyClone, Logan, UT, USA). Cells were cultured at 37 °C in 5% CO2. On the third day in vitro (DIV 3), when the astrocytes had grown sufficiently to form a monolayer covering the entire coverslip, cells were treated with the mitotic inhibitor FUDR (5-fluoro-2′-deoxyuridine, Sigma, F0503). Calcium phosphate transfections were carried out at DIV 7 using standard protocols [63].

As previously characterized [62, 64, 65], pyramidal neurons account for ~ 90% of total cultured neurons, with the rest being GABAergic interneurons. Pyramidal neurons and GABAergic neurons have distinctive morphologies, with the somata of the latter being more fusiform or polygonal in shape and having fewer primary dendrites [65]. Pyramidal neurons were selected for further analyses based on these criteria.

Immunocytochemistry, Pharmacology, and Data Analysis

The following antibodies were used: Anti-GluA1 (N-terminus, clone RH95, Millipore, MAB2263, RRID: AB_11212678; 1:200), MAP2 (Millipore, AB5622, RRID: AB_91939; 1:1000), Donkey anti-Mouse Alexa Fluor 488 (Thermo Fisher Scientific, R37114, RRID: AB_2556542; 1:1000), Goat anti-Rabbit Alexa Fluor 568 (Thermo Fisher Scientific, A78955, RRID: AB_2925778; 1:1000). DIV 12 culture hippocampal neurons were treated with conditional medium containing anti-N-GluA1 antibody and CCL2 (100 ng/mL), or equal amount of BSA (vehicle), and incubated for 20 min, at 37 °C and in 5% CO2. For pretreatment experiments, RS504393 (R&D, 2517, 10 µmol/L), U73122 (Sigma, U6756, 5 µmol/L), KN-93 (Tocris, 1278, 20 µmol/L), PKI 14-22 (Tocris, 2546, 5 µmol/L) or DMSO (vehicle, Sigma, D2650; 0.1 % v/v) were added 30 min before BSA/CCL2 application. After drug treatment, neurons were washed twice with warm PBS, and fixed using cold 4% PFA for 15 min at room temperature, permeabilized, and processed for immunocytochemistry according to standard protocols. Images were acquired on a Nikon A1 confocal microscope with a Plan Apo 60× oil-immersion objective (N.A. = 1.40) at 0.5 μm Z intervals. Maximum projection images were analyzed using Image-Pro Plus 6.0 (Media Cybernetics, Rockville, MD, USA). The total surface area or intensity of GluA1 of each image frame was normalized to that of MAP2.

All images were coded using random sequences (https://www.random.org/sequences/) at the time of acquisition and analyzed blindly to the experimental condition. For example, images, and brightness/contrast were adjusted within linear ranges using Fiji/ImageJ when necessary. Control and experimental conditions were adjusted using the same parameters.

Live Imaging and Data Analysis

Live imaging experiments were carried out on a Nikon A1 confocal microscope with a Plan Apo 60× oil-immersion objective (N.A. = 1.40), at 2× optical zoom and 0.5 μm Z intervals; images were acquired at 5-min intervals. DIV 7 neurons were transfected with SEP-GluA1, GluA2, and DsRed2 (at a ratio of 9:9:2) to mimic endogenous GluA subunit ratios [57]. Live imaging was performed at DIV 14–15. Neurons grown on 35-mm glass bottom dishes were placed in a Stage Top Incubator (Tokai Hit, Japan), and the environment was maintained at 37 °C and 5% CO2. Recombinant rat CCL2 (100 ng/mL) or BSA (vehicle) was added to the culture medium after baseline images were acquired. Neurons were pretreated with RS504393 (R&D, 2517, 10 µmol/L) for 30 min before BSA/CCL2 application. Images were analyzed using Image-Pro Plus 6.0 (Media Cybernetics, Rockville, MD, USA).

Analysis of surface SEP-GluA1 expression was limited to spines, using the following criteria: (1) located on secondary dendrites; (2) stable baseline; (3) presented in at least 4 images (6 total); less than 5 µm in length. The region of interest (ROI) was marked in the morphology channel (DsRed2), and the area and total intensity of the SEP-GluA1 channel were ratioed to that of the DsRed2 channel. For quantification of before and after treatment, “before” included the − 5 min and 0 min time points, while “after” included the 5 min, 10 min, 15 min, and 20 min time points. 4–5 independent culture preparations were used per condition.

Calcium Imaging in Cultured Hippocampal Neurons

Cultured hippocampal neurons were infected with AAV2/9-hSyn-jGCaMP7b-WPRE-pA (0.5 μL, 1.42 × 1013 TU/mL, S0591-9, Shanghai Taitool Bioscience) at DIV 4, and imaged at DIV 14. Imaging was carried out on a Nikon A1 confocal microscope, with a Plan Apo 20x objective (N.A. = 0.75); A perfect focus system (PFS) was used, and images were acquired at 2 (baseline), 10 and 15 min, continuously for 90 s at 1.33 Hz at each data point  (~ 120 frames). BSA (vehicle) or recombinant rat CCL2 (100 ng/mL) was perfused from 3 min to 15 min in the extracellular solution contained (in mmol/L; NaCl 129, KCl 5, glucose 30, HEPES 25, CaCl2 2, and MgCl2 1; pH 7.3; 310 mOsm).

Calcium transients were identified using PeakCaller [66]. Parameter settings were as follows: required rise = 80% absolute; max. lookback = 10 pts; required fall = 80% absolute; max. lookahead = 10 pts; trend control = no trend. Average peak amplitudes and frequencies of calcium transients were normalized to baseline fluorescence. All image analyses were carried out with no post-acquisition modifications. Example images under control and experimental conditions were adjusted with the same parameters.

Electrophysiology in Cultured Hippocampal Neurons

Electrophysiology was performed as previously described [67]. Briefly, whole-cell mEPSC recordings of hippocampal neuronal cultures (DIV 8-10) were made with a MultiClamp 700B amplifier (Molecular Devices, Sunnyvale, CA, USA). Neurons were held at − 70 mV in a voltage clamp. Signals were filtered at 2 kHz and sampled at 10 kHz using Digidata 1550B (Molecular Devices). TTX (0.5 μmol/L) and Gabazine (10 μmol/L) were added to artificial cerebrospinal fluid (aCSF) to block Na+ channels and GABAA receptors, respectively. The aCSF contained (in mmol/L): NaCl 125, KCl 2.5, NaH2PO4 1.3, MgCl2 1.3, CaCl2 2, NaHCO3 25, and Glucose 20. One neuron from each coverslip was recorded, first perfused in BSA (vehicle) for 4–5 min and then in CCL2 (100 ng/mL).

Data were analyzed in MiniAnalysis (Synaptosoft, Fort Lee, NJ) with an amplitude detection threshold of 5 pA. Data were analyzed blinded to treatment. During recording, a brief hyper-polarization (− 10 mV, 100 ms) was given to monitor series and input resistances every 10 s. Neurons with series resistance of more than 20 MΩ or changes of series resistance of greater than 20% were excluded from analysis.

Western Blots

Western blots were performed as previously described [35]. Mice were deeply anesthetized with 0.7% sodium pentobarbital at 0.14 g/kg body weight. The brains were removed quickly, and the hippocampi were dissected. Brain samples were homogenized with a motorized tissue grinder in HEPES buffer (0.32 mol/L sucrose and 4 mmol/L HEPES, pH 7.4) containing freshly added protease inhibitor cocktail tablets (Roche, 04693132001) and phosphatase inhibitor cocktail tablets (Roche, 4906845001). The total homogenates were centrifuged at 1000 g for 10 min to remove the nuclear fraction. The supernatant was collected and then centrifuged at 10,000 g for 20 min to yield the crude membrane fraction (P2).

For purifying synaptosome membrane fractions, the P2 fraction was resuspended with HEPES buffer (0.32 mol/L sucrose and 4 mmol/L HEPES, pH 7.4) and centrifuged at 10,000 g for 15 min to yield the washed P2, followed by hypotonic treatment (ddH2O treated with protease inhibitor cocktail tablet) to rupture vesicles. 1 mol/L HEPES (pH 7.4) was quickly added to maintain the osmotic pressure of the solution at 4 mmol/L HEPES; solutions were incubated on ice for 1 h for thorough lysis. The lysed solution was centrifuged at 25,000 g for 20 min to yield the pellet (P3, lysed synaptosomal membrane fraction). The P3 then was resuspended and added onto a discontinuous sucrose gradient (top to bottom, 0.85/1.0/1.2 mol/L sucrose in 4 mmol/L HEPES with protein inhibitor), followed by ultracentrifugation at 30,000 r/min for 2 h at 4 °C; the fraction between 1.0 mol/L and 1.2 mol/L was collected as P4. 15 µg of samples (P2 or P4) were loaded per lane; PVDF membranes were blocked in 5% BSA blocking solution, and incubated with primary antibodies overnight at 4 °C; HRP-conjugated secondary antibodies incubation was 1 h at room temperature. For quantification of phosphorylation levels, the phosphorylation-site-specific antibodies were stripped from the membranes using stripping buffer (Thermo Scientific, 46430) for 30 min at room temperature, followed by blocking in 5% BSA blocking solution for 1 h, and then reprobed with anti-total protein antibodies.

The following primary antibodies were used: GluA1 (Millipore, AB1504, RRID:AB_2113602; 1:1000), GluA1 S831 (Abcam, ab109464, RRID:AB_10862154; 1:1000), GluA1 S845 (Abcam, ab76321, RRID:AB_1523688; 1:1000), GluA2 (Millipore, MAB397, RRID:AB_2113875; 1:1000), GluA2 S880 (Abcam, ab52180, RRID:AB_880227; 1:1000), CaMKII (Invitrogen, MA1-048, RRID:AB_325403; 1:1000), CaMKII T286 (Abcam, ab5683, RRID:AB_305050; 1:1000), PKA (Cell signaling, #4782, RRID:AB_2170170; 1:1000), PKA T197 (Cell signaling, #4781, RRID:AB_2300165; 1:1000), and GAPDH (Kangchen Biotech, KC-5G4, RRID:AB_2493106; 1:5000). The following secondary antibodies were used: HRP conjugated goat anti-mouse IgG Antibody (ZSGB-Bio, ZB-2305; RRID: AB_2747415; 1:2500) and HRP conjugated goat anti-mouse IgG Antibody (ZSGB-Bio, ZB-2301, RRID: AB_2747412; 1:2500). Signals were visualized using an ECL Plus kit (PE0010, Solarbio, China). Blots were quantitated using Fiji/ImageJ (N.I.H, Bethesda, MD) and normalized to the gray value of GAPDH or total protein (for phosphorylation-site-specific antibodies).

Tail Suspension Test (TST)

A tail suspension test was carried out as previously described [35]. P14 mice were suspended 30 cm above the floor, by tape placed about 1 cm from the end of the tail. Videos were recorded from the mouse’s ventral side. Immobility percentage within 6 min was analyzed blinded to the experimental condition using the “FST/TST” module in the SMART video tracking system (Panlab 3.0, Harvard Apparatus, Holliston, MA, USA).

Statistical Analysis

Statistical analyses were performed using GraphPad Prism 9 (GraphPad Software, La Jolla, CA, USA). Data were analyzed blinded to the experimental condition. Gaussian distribution of the data was assessed using the Shapiro-Wilk normality test, KS normality test, Anderson-Darling test, or D’Agostino & Pearson normality test. If data passed the Gaussian distribution test, parametric tests (paired two-tailed t-test or unpaired two-tailed t-test for two groups; or one-way ANOVA with Tukey’s post hoc test for three or more groups) were used; otherwise, nonparametric tests (Mann-Whitney for unpaired two groups, Wilcoxon matched-pairs signed rank test for paired two groups) were used. For surface GluA1 staining, SEP-GluA1 live imaging, and calcium imaging, two-way ANOVA followed by the Bonferroni post hoc test was used. Cumulative distributions were tested using the Kolmogorov-Smirnov test. For western blotting experiments and tail suspension test, n represents the number of mice; for reporter assays, n represents independent wells; for immunocytochemistry and electrophysiology, and calcium imaging experiments, n represents the number of neurons; for SEP-GluA1 imaging, n represents the number of spines. At least three mice or independent cultured neuronal preparations were used per experimental condition. Results are shown as mean ± SEM and statistical significance was set at *P < 0.05, **P < 0.01, ***P < 0.001; n.s., not significant.