WES (whole-exome sequencing) and filtering analyses

Genomic DNA was extracted from the peripheral blood of the proband, his sister, and the parents using a QIA amp DNA blood mini kit (QIAGEN, Venlo, Netherlands) and sequenced by WES. WES and variant filtering analyses were performed as previously described with slight modifications [20]. In brief, after sharing the DNA with a Covaris Focused-ultrasonicator S220 (Woburn, MA, USA), the sequence library was prepared using a Human All Exon V6 Kit (Agilent Technologies, Santa Clara, CA, USA) and sequenced using a 2500 Illumina with 125-bp paired-end reads (Illumina, San Diego, CA, USA). Sequence reads were aligned to GRCh38 and annotated using CompStor NOVOS and CompStor Insight, which carry a proprietary Novos caller and annotation engine (OmniTier, San Jose, CA, USA). The filtering procedure for the annotated variants is as follows: first, variants with allele frequencies > 0.01 were removed from the public databases gnomAD and 14 KJPN (jMORP) as well as our in-house exome variant data consisting of more than 7,000 WES data. Next, the variants were narrowed down based on assumed modes of inheritance, such as autosomal dominant, autosomal recessive, X-linked, and compound heterozygous. Finally, two variants of LARS1 and one variant of LAMA4 were co-segregated, with the latter variant not exhibiting concordant clinical symptoms (S1 Table). No pathogenic copy number variations were detected in the WES data. The two LARS1 variants were confirmed by Sanger sequencing (ABI3130) using the primers 5′- GGGTCTCATAACAATGAATACTTC -3′ and 5′- GGGAAAAGGTAGGCTACAAGG -3’ for NM_020117:c.601 T > G and 5′- GGCAGTGTCGTAATGACATATAC-3′ and 5′-CCATAGAGATTCCTAGAGGG-3′ for c.1351A > T.

Zebrafish maintenance

The larsb mutant and Tg[fabp10:mcherry] zebrafish AB genetic background were raised and maintained following standard procedures [21, 22]. They were maintained at 28–29 °C under a 14-h:10-h light:dark cycle. Embryos were collected and housed at 28.5 °C.

All animal experimental procedures were performed in accordance with the institutional and national guidelines and regulations. The study was conducted in compliance with the ARRIVE guidelines.

Generation of the larsb I451F zebrafish line

The larsb I451F zebrafish line was generated via CRISPR/ Cas9 gene editing [23, 24]. The site of the larsb sgRNA target was 5′-CCAAAGCCAGAATGACAGAGAGA-3′ in the editing domain of the LARS protein. Single-stranded oligodeoxynucleotides (ssODNs) were designed with the following sequences (phosphorothioate modifications in the first and last nucleotides) and ordered as ultramers by Integrated DNA Technologies (Coralville, IA, USA) to generate single-nucleotide polymorphisms: A*G*TGGCTTATTGGTTTGTTCTACCAGGTTCCCATCATTGAAATTCCAGGGTATGGGAATCTGTCAGCTCCACTGGTGTGCGATGAACTGAAGTTTCAAAGCCAGAATGACAGAGAGAAACTGGCCGAGG*C*T. The microinjection solution (1 nl; Cas9 protein [300 pg], gRNA [30 pg], ssODNs [41 pg], and 0.1% phenol red) was microinjected into single-cell-stage wild-type (WT) embryos. The microinjected zebrafish were raised to adulthood and screened for germline transmission of larsb mutations through natural breeding. We crossed adult microinjected zebrafish with WT zebrafish and collected 20 embryos into a single polymerase chain reaction (PCR) tube, which was then heated at 95 °C for 15 min in 180 μL of 50 mM NaOH. Subsequently, 20 μL of 1 M Tris–HCl was added to each sample. The DNA extraction sample was used as a template, and PCR was performed using the larsb I451F forward primer 5'-TGTGCGATGAACTGAAGTTT-3' and larsb reverse primer 5'- CACATCTCCTTTCATGCGTTT-3,’ with GoTaq DNA polymerase (Promega, WI, USA). These primers were designed to specifically recognize knock-in sequences. The PCR program was as follows: 95 °C for 2 min, followed by 35 cycles at 95 °C for 30 s, 63 °C for 30 s, and 72 °C for 12 s. Targeted mutations were verified by Sanger sequencing of PCR-positive zebrafish embryo DNA obtained from genotyped PCR. The primers used for Sanger sequencing were the larsb forward primer 5'-TCATGCCAAGTCAAGTCCTG-3' and larsb reverse primer. The F0 founder, with germline transmission, was selected to establish a knock-in zebrafish line. The F1 generations were raised to adulthood, had their fins clipped, and were sequenced. Consequently, a homozygous larsb I451F zebrafish line (larsb I451F zebrafish line) was identified.

Generation of transgenic zebrafish

Tg[fabp10:mCherry] fish expressing mCherry exclusively in hepatocytes were generated using a MultiSite Gateway kit (Thermo Fisher Scientific, Waltham, MA, USA) to produce vectors with Tol2 transposon sites [25]. A 2.8-kb promoter of the zebrafish fabp10 gene [21] was amplified from genomic DNA in WT zebrafish by PCR (KOD-plus-Neo; Toyobo, Osaka, Japan). The PCR primers used were the fabp10 forward primer 5'-AAAAAGCTTGCAGTAAATTGATTCAAACT-3' and fabp10 reverse primer 5'-AAAGGATCCGCTTTCTGGAGAAGCTCAAC-3'. The PCR program was as follows: 94 °C for 2 min, followed by 30 cycles at 98 °C for 10 s, 60 °C for 30 s, and 68 °C for 90 s. The PCR mixture was subjected to agarose gel electrophoresis, and the desired bands were isolated and purified from the gel. Subsequently, the purified band was digested with restriction enzymes HindIII and BamHI. The digested PCR product was then ligated with the p5E-mcs vector, which was digested with the same enzymes using Ligation High (Toyobo). Multisite Gateway cloning [26] was performed using the destination vector pDestTol2pA2, the 5′ entry vector containing the fabp10 promoter, the middle entry vector containing pME-mCherry, and the 3′ entry vector containing p3E-polyA. DNA constructs (25 pg) and Tol2 mRNA (25 pg) were microinjected into WT zebrafish embryos at the single-cell stage. Six days post-injection, fish were examined using fluorescence microscopy, and mcherry-expressing fish were saved. Germline-integrated transgenic zebrafish were selected from these mcherry-positive fish by raising them to sexual maturity and breeding them with WT zebrafish.

WES automated simple Western blot assay

Samples were lysed with lysis buffer (0.5% NP-40, 10% glycerin, 50 mM HEPES–KOH [pH 7.8], 150 mM NaCl, and 1 mM EDTA) using protease and a phosphatase inhibitor cocktail (Thermo Fisher Scientific). Protein samples were separated by capillary electrophoresis using 12- 230-kDa Wes Separation Module capillary cartridges in a Simple Protein Wes system (ProteinSimple Wes; ProteinSimple; San Jose, CA, USA), according to the manufacturer's protocol. The following antibodies were used: Lars (#13,868; Cell Signaling Technology, Beverly, MA, USA; 1:50) and β-actin (A3854; Sigma-Aldrich, St. Louis, MO, USA; 1:100). The anti-rabbit and anti-mouse modules for the Wes kit (DM-001 and DM-002; ProteinSimple), which include luminol-S, peroxide, antibody diluent 2, streptavidin-HRP, anti-rabbit secondary antibody, and anti-mouse secondary antibody, were used for detection. The intensities of the acquired chemiluminescence signals were quantified using the AlphaView and Compass software programs (ProteinSimple).

Morphological analyses

Zebrafish larvae were placed in 3% methylcellulose and images were acquired using a Leica M205 FA fluorescent stereo microscope (Leica, Wetzlar, Germany). Tg[fabp10:mcherry] larvae were immobilized in 3% methylcellulose and imaged in vivo using an RFP fluorescence filter. Hepatic structures were traced, and area and circularity were quantified using the ImageJ Fiji software program (1.53t; National Institutes of Health, Bethesda, MD, USA) [27, 28].

Histopathological staining and fluorescent immunostaining

Histopathological staining and fluorescent immunostaining were performed on paraffin-embedded or frozen sections. For histopathological staining, 5 days post-fertilization (dpf) larvae zebrafish were fixed in 4% paraformaldehyde (PFA) overnight. Tissues were then dehydrated, embedded in paraffin, and sectioned to 5-µm thickness. The samples were initially stained with a hematoxylin solution for 20 s and rinsed with deionized water. They were then stained with eosin solution for 60 s, rinsed again with deionized water, and dehydrated using a series of ascending ethanol concentrations. Excess protein was removed using xylene for 30 s (three repetitions). Finally, the coverslips were mounted using mounting medium. Cryosectioning was performed to obtain samples for immunofluorescence staining. Samples were fixed with 4% PFA for 16 h and then incubated in a microcentrifuge tube with 30% sucrose in phosphate-buffered saline until samples sank down to the bottom of the tube. Samples were then transversally embedded in a mixture of 30% sucrose and Tissue-Tek O.C.T. Compound (4583; Sakura-Finetek, Tokyo) (2:1) and fixed in liquid nitrogen. Sections of 10-µm thickness were obtained using a Leica CM1950 microtome.

An immunofluorescence analysis was performed using the following primary antibodies: anti-p62 (PM045; Medical & Biological Laboratories, Nagoya, Japan) and anti- LC-3 pAb (PM036; Medical & Biological Laboratories). Alexa Fluor 488 donkey anti-rabbit IgG (A21206; Molecular Probes, Eugene, OR, USA; 1:500) was used as the secondary antibody. Images were captured using a laser-scanning microscope (BZ-9000; Keyence, Osaka, Japan).

Fluorescent staining of accumulated lipids

Fluorescent staining of accumulated lipids was performed on the sections. Zebrafish larvae at 5 dpf were fixed in 4% PFA overnight. Frozen samples were rinsed with phosphate-buffered saline. The samples were then stained with 1 μM Lipi Dye II solution (Funakoshi, Tokyo, Japan) in phosphate-buffered saline and incubated for 1 h at 37 °C. The cells were rinsed three times with phosphate-buffered saline and mounted with fluorescence mounting medium (S3023; Dako, Agilent Technologies). Images were captured using a laser-scanning microscope (BZ-9000; Keyence).

Bafilomycin A1 and A922500 treatments

In experiments employing autophagy inhibitors, embryos were treated in embryo medium from 72 to 120 h post-fertilization (hpf) for a morphological analysis, with Bufilomycin A1 (2.5 nM; EMD Millipore, Darmstadt, Germany) or dimethyl sulfoxide (DMSO) as a control. For experiments utilizing DGAT1 inhibitors, embryos were similarly treated in embryo medium from 72 to 120 hpf for the morphological analysis, with A922500 (2 mM; Sigma-Aldrich, St. Louis, MO, USA) or DMSO as a control. The medium containing the compounds was changed daily.

Statistical analyses

Statistical analyses were performed using the GraphPad Prism software version 8 (GraphPad Software, Inc., San Diego, CA, USA). All values are expressed as the mean ± standard error of the mean. Shapiro–Wilk and Brown–Forsythe tests were performed to analyze the normal distribution and homogeneity of the data, respectively. The different groups were compared using the nonparametric independent samples Kruskal–Wallis test for non-normally distributed variables, and the results obtained were expressed as median and interquartile ranges. In contrast, when the data had a normal distribution, they were analyzed using a one-way analysis of variance (ANOVA) followed by Tukey’s pairwise comparison tests. Statistical differences in the survival curves were analyzed using the log-rank (Mantel-Cox) test. Statistical significance was set at P < 0.05.