2.1 Bioinformatics analysis

TNM stage, clinical stage, overall survival (OS) data, and HDAC10 in RCC (KIRC) expression levels in the organization were obtained from the TCGA database (https://xenabrowser.net/heatmap/). Gene enrichment analysis (GSEA) was conducted to identify the signaling pathways implicated in the pathogenesis of ccRCC under conditions of elevated HDAC10 expression.

2.2 Patient samples and cell lines

This study was approved by the Medical Ethical Committee of Shandong Provincial Hospital and written informed consent in accordance with the Declaration of Helsinki was obtained from each patient. The paraffin-embedded tissue of the patient in the study was re-embedded into new blocks for Immunohistochemical staining. Pathological specimens and clinicopathological characteristics were collected, and all samples were anonymous. Normal human embryonic kidney cell lines HEK-293 and human renal cell cancer cell lines 786-O, 769-P, Caki-1, Caki-2, OS-RC-2, and A498 were sourced from Procell. Cells were cultured in a medium supplemented with 10% fetal bovine serum (EXcellBio, Shanghai) and a penicillin/streptomycin mixture (Solepol Technology Co, Ltd, Beijing). The cells were incubated in a carbon dioxide incubator.

2.3 Immunohistochemical (IHC) staining

Immunohistochemistry (IHC) was performed using standard immunoperoxidase staining protocols with examination of the specimens at 200 × and 400 × magnification. Two observers independently analyzed the staining results and calculated the corresponding IHC score. Rabbit antibodies against HDAC10 (Proteintech, USA) were used as the primary antibodies, and HRP-labeled goat anti-rabbit IgG (Xavier Biotechnology Ltd, Wuhan) was utilized as the secondary antibody.

2.4 Lentiviral vector construction and cell transfection

Three specific sequences of HDAC10 were targeted using three shRNAs, designated as HDAC10 shRNA1: 5'-GATCCCGCCGGATATCACATTGGTTCTCTCGAG- AGAACCAATGTGATATCCGGCTTTTTGGAT -3'; HDAC10 shRNA2: 5'-GATCCCGCAGGTGAACAGTGGTATAGCCTCGAG-GCTATACCACTGTTCACCTGCTTTTTGGAT-3'; HDAC10 shRNA3: 5'-GATCCCGGCACCTGAACAGTGGTATAGCTCGAG-CTATACCACTGTTCACCTGCCTTTTTGGAT-3'. The sequences were forwarded to Genechem, where the lentiviral vector was constructed by Genechem Packaging. Afterward, the lentiviral vector was utilized to transduce the cells, and the downregulation of HDAC10 expression was verified by qRT-PCR at the RNA level, as described in the subsequent section.

2.5 qRT-PCR

TRNzol universal total RNA extraction reagent (Beijing Tiangen Biochemical Technology Co., LTD.) was used to extract total RNA according to the manufacturer's scheme. Reverse transcription of RNA was performed according to the instructions using FastQuant cDNA first strand synthesis kit (KR116). Then qRT-PCR was performed, and the results were analyzed by 2−ΔΔCt. Primers used for PCR amplification are shown in Supplementary Table 1.

2.6 Western blotting

Total protein was extracted initially, followed by determining the protein concentration using the BCA method. The protein solution sample was mixed with 5 × SDS-PAGE protein loading buffer at a 4:1 ratio and shaken well. The mixture was loaded onto the SDS-PAGE gel for electrophoresis and then transferred to the PVDF membrane. The membrane was incubated with HDAC10 (Proteintech, USA), GAPDH (Zhongshan Jinqiao, Beijing), actin (Zhongshan Jinqiao, Beijing), and other primary antibodies overnight. Afterward, the PVDF membrane was washed with TBST and incubated with the corresponding secondary antibody for 1 h. Finally, the PVDF membrane was exposed using an exposure solution.

2.7 Colony formation assay

A cell concentration of 1500 cells/well was added to a 6 cm petri dish. The growth medium was replaced every three days, and the cells were cultured for approximately ten days. After that, the medium was removed, cells were fixed with 4% paraformaldehyde for 30 min, and stained with 1 ml of 0.1% crystal violet solution per well for 10–30 min.

2.8 Cell proliferation assay

Cell proliferation was assessed using an MTT assay kit (Seville Biotech Ltd., Wuhan). A cell density of 105 cells per well was inoculated onto a 96-well plate. The cells were gently agitated, adding 20 μl of 5 mg/ml MTT solution to each well. The plate was then incubated in the incubator for 4 h. Cell proliferation was assessed by measuring the absorbance at 570 nm, and the resulting absorbance readings at different time points were used to construct cell proliferation curves.

2.9 Migration assays

The undersurface of the Transwell system (24-well plate, Corning Corporation) was coated with 500μL medium containing 10% serum. The upper chamber was loaded with 300μL of cells in a serum-free medium. Following a 24-h incubation, the cells in the Transwell chamber were fixed in a plate containing a paraformaldehyde solution for 30 min. Next, the cells were stained with a 0.1% crystal violet solution for 10 min. Images were captured and analyzed using fluorescence microscopy, with three high-power fields chosen randomly for cell counting.

2.10 Cell cycle and apoptosis

After trypsinization, Cells were harvested and subjected to staining using the Cell Cycle staining kit (Hangzhou Unitech Biotech Ltd) per the manufacturer's instructions. Before staining take care to incubate the cells at 37 °C away from light for 30 min. Annexin V-APC/7-AAD Apoptosis Kit (Hangzhou Unitech Biotech Ltd) was also used for apoptosis analysis. Flow cytometry was then employed to determine the cell cycle distribution and measure apoptosis.

2.11 Xenograft tumor model in vivo

Ten male BALB/c nude mice, aged 4–6 months, were procured from the Experimental Shopping Center of Shandong University. After one week of acclimatization, the ten nude mice were randomly assigned to the shNC and shHDAC10-2 groups. The subcutaneous xenograft tumor model was established by injecting 0.2 ml of A498 cell suspension, transfected with shNC and shHDAC10-2, respectively, into the subcutaneous axillary tissue of nude mice (1 × 107 cells per injection). Once the tumors became visible, their longitudinal and transverse diameters were measured and recorded using vernier calipers, and the average measurements were calculated for each group. All procedures were approved by the Animal Care and Use Committee at Shandong Provincial Hospital.

2.12 Statistical analysis

Statistical analyses were performed using Graphpad Prism 8.0 (GraphPad Software, San Diego, CA). All quantitative data are the mean ± standard deviation of three independent experiments. One-way ANOVA was used to assess the relationship between variables. Kaplan–Meier analysis was performed for survival curves. P < 0.05 differences were statistically significant (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001).