Construction of MI mice model

After anesthetization, male C57BL mice were incubated and ventilated with a rodent ventilator. Then, thoracotomy and pericardiotomy were performed followed by left anterior descending (LAD) coronary artery ligation. The sham group mice underwent the same operations, except that LAD coronary artery ligation was not performed. After 4 weeks, induction of heart failure was confirmed by echocardiography, and mice were sacrificed. All studies were approved by the Committee for Animal experimentation and fulfilled the requirements for humane animal care from Tangdu Hospital, Air Force Medical University. For the experimental group, the model mice were treated intragastrically (i.g.) with EGCG (50 mg/kg) once daily by oral gavage under the condition transfected with or without lentivirus of shMEG3.

Measurement of myocardial injury

A Vivid 7 Dimension echocardiography machine was performed on isoflurane-anesthetized mice to evaluate cardiac function. Left ventricular ejection fraction (LVEF), EF, and fractional shortening (FS) were measured as previously reported [16].

Creatine kinase-MB (CK-MB) and lactate dehydrogenase (LDH), the biomarkers of tissue damages including myopathy and MI, were detected by corresponding ELISA kits.

Collection of tissues

Treated mice were sacrificed after being sedated with pentobarbital sodium (50 mg/kg) administered intraperitoneally. The mice chest was opened, the mice heart was removed, and the atria, large blood vessels and the hoof tissue of the heart were removed. And the tissue was obtained, and fixed.

TTC staining

The hearts of mice in different groups were frozen at a −80 °C refrigerator for 8 min, then cut into five thick circular slices, respectively (0.1–0.3 cm). Afterwards, the slices were immersed in prepared TTC solution and cultured at 37 °C for half of hour (protected from light), followed by incubating in 10% formaldehyde for a week. Finally, slices were arranged from big to small in order and photographs were acquired by Sony camera to observe infarction size of myocardial.

Hematoxylin and eosin (H&E) staining

After fixation in 4% paraformaldehyde, heart tissues from each group were washed and embedded in paraffin, followed by slicing with a microtome into 5 μm sections. After dewaxing and dehydrating, slices were stained with hematoxylin and eosin. Slices were then imaged using a microscope (Olympus, Tokyo, Japan).

Masson’s trichrome staining

Formaldehyde-fixed paraffin-embedded tissues (5 µm sections) were used for Masson’s trichrome stain to detect the interstitial fibrosis. The collagen fibers stains blue, the cytoplasm stains red, and the nuclei stains black.

Immunohistochemistry (IHC)

Deparaffinized and rehydrated sections were boiled in Na-citrate buffer for antigen retrieval, followed by incubating with anti-AIM2 (1:500, ab93015, Abcam) at a dilution of 1:200 overnight. Afterward, slices counterstained with hematoxylin, dehydrated and coverslipped. Images were acquired by a microscope at a magnification of 200.

Cell culture and establishment of in vitro myocardial I/R model

HL-1 and 293 T cells offered by Cell Bank of Chinese Academy of Sciences (Shanghai, China) were kept in DMEM supplemented with 10% fetal bovine serum, 100 μg/mL streptomycin and 100 U/mL penicillin (all from Gibco, Carlsbad, USA) with 5% CO2 at 37 °C. Myocardial I/R model was constructed through oxygen–glucose deprivation/reperfusion (OGD/R) stimulation. Briefly, HL-1 cells were suspended in sugar-free DMEM and cultured in an anoxic chamber containing 95% N2 and 5% CO2 for 2, 4, 8, or 12 h, followed by maintenance in normal culture condition for 24 h as reperfusion. HL-1 cells were incubated with EGCG (0, 5, 10, 20, 40, 80 or 100 μM, Sigma Aldrich, St Louis, MO, USA; E171) for three hours prior to OGD/R treatment.

Cell transfection

Short hairpin RNA (shRNA) targeted MEG3, TAF15, FUS, EIF4A3, DGCR8, EWSR1, ELAVL1 (shMEG3, shTAF15, shFUS, shEIF4A3, shDGCR8, shEWSR1, shELAVL1) or scrambled oligonucleotides purchased from GenePharma (Shanghai, China) were inserted into pGLVH1 vector. The MEG3 or TAF15 fragments were cloned into pcDNA3.1 (Invitrogen, Carlsbad, CA, USA) vector (oe-MEG3, oe-TAF15). Lipofectamine 3000 was adopted to conduct the transfection of the above vectors into HL-1 cells. All sequences related to transfection were shown as follow: shMEG: 5'- CACCGCAGAAACCAGTATTGAAATGCGAACATTTCAATACTGGTTTCTGC -3';

shTAF15: 5'- CACCGGACAAACACCACAAGGTTATCGAAATAACCTTGTGGTGTTTGTCC -3';

shFUS: 5'- CACCGCAGCTATGGTTCTTCTTATGCGAACATAAGAAGAACCATAGCTGC -3';

shEIF4A3: 5'-CACCGCAGCAGCGTGCTATCAAGCAGATAACGAATTATCTGCTTGATAGCACGCTGCTG-3';

shDGCR8: 5'-CACCGGAGACATATGAGAGTCCCTCTCCTCGAAAGGAGAGGGACTCTCATATGTCTCC-3';

shEWSR1: 5'-CACCACAGTGCAATTTATGTGCAAGGATTCGAAAATCCTTGCACATAAATTGCACTG-3';

shELAVL1: 5'-CACCGGATGACATTGGGAGAACGAATTTACGAATAAATTCGTTCTCCCAATGTCATCC-3';

For silencing MEG3 in mouse model, the adeno-associated virus serotype 9 (AAV9) vectors carrying a shMEG3 were constructed as described previously [17]. Mouse model received the virus solution (2 × 1011 genome-containing particles (GC)/animal) via tail vein injection.

Nuclear-cytosol fractionation

The NE-PER Nuclear Cytoplasmic Extraction Reagent kit (Thermo Fisher Scientific, Waltham, MA, USA) was used for nucleocytoplasmic separation. Briefly, suspended cells were centrifuged at, followed by discarding the supernatant. Subsequently, cytoplasmic extraction reagent I, cytoplasmic extraction reagent II, and nuclear extraction reagent were added sequentially according to the protocols to obtain nuclear and cytoplasmic extracts. Finally, trizol was added to extract nuclear and cytoplasmic RNAs, and qRT-PCR was used to further analyze the expression of MEG3, GAPDH, and U6 in the nucleus and cytoplasm.

Measurement of mRNA stability

Traeted cells were seeded in 6-well plates and treated with actinomycin-D (act-D), which was added to inhibit further RNA synthesis at a final concentration of 5 μg/mL, for 0, 1, 2, 4, or 8 h. Total RNA was extracted by Trizol reagent and analyzed by qRT-PCR.

CCK-8

Treated cells were plated into 96-well plates (5000 cells per well) and cultured for 48 h. Next, CCK-8 reagent (10 µL) was added to each well and incubated with cells for 1 h at 37 °C. At 48 h post-transfection, cell viability was detected at 450 nm by a spectrophotometer (BioRad, Hercules, CA, USA). The results represent the mean of three replicates under the same conditions.

TUNEL assay

DNA fragmentation in HL-1 cells were measured by the DeadEnd™ Fluorometric TUNEL System (Promega, Madison, WI, USA; G3250). Cells were stained by DAPI to identify the nuclei followed by visualization under fluorescence microscope. TUNEL-detected DNA stains green, and overlapped green and blue nuclear fluorescence indicates DNA fragmentation due to cell death.

Quantitative real-time PCR (qRT-PCR)

Total RNAs of treated tissues or cells were extracted with Trizol reagent (Invitrogen), and then was reverse-transcribed to cDNA with Prime-Script RT-PCR master mix (Takara, Tokyo, Japan). RT-qPCR detection was performed with SYBR Green qPCR (Applied Biosystems, Carlsbad, CA, USA; 4309155). β-actin was served as internal controls for mRNA. The gene expression levels were presented as fold changes relative to the expression levels of appropriate controls using the 2–ΔΔCt method. The following primer sets were used: MEG3, forward (5ʹ–3ʹ) TCCTCACCTCCAATTTCCCCT, reverse (5ʹ–3ʹ) GAGCGAGAGCCGTTCGATG; AIM2, forward (5ʹ–3ʹ), AAAACTGCTCTGCTGCCCT, reverse (5ʹ–3ʹ); TCAGCACCGTGACAACAAGT; TAF15, forward (5ʹ–3ʹ), GGGGAAGCAACAGTGTCATT, reverse (5ʹ–3ʹ); AAAACCTCCACGGCCTCTAT; β-actin, forward (5ʹ–3ʹ) GGCTGTATTCCCCTCCATCG, reverse (5ʹ–3ʹ) CCAGTTGGTAACAATGCCATGT;

Western blot analysis

After isolating total proteins using RIPA buffer (Invitrogen), fifty-gram proteins of each group were subjected for purification using 10% SDS–polyacrylamide gels. Afterwards, transferred the purified proteins to PVDF membranes followed by blocking non-specific sites using 5% skim milk. The membranes were then subjected to primary antibodies incubation overnight at 4 °C, and corresponding HRP- conjugated secondary antibody (1:5000, sc-2004, Santa Cruz Biotechnology) were used to probe the related primary antibodies. The antibody-reactive bands were detected with ECL reagent (Millipore Corp, Billerica, MA, USA). The following primary antibodies were used: anti-AIM2 (1:1000, ab93015; Abcam, Cambridge, MA, UK), anti-ASC (1:2000, ab180799, Abcam), anti-C-caspase-1 (1:1000, ab179515, Abcam), anti-GSDMD-N (1:2000, PA5-116815, Thermo Fisher), anti-IL-18 (1:2000, ab52914, Abcam), anti-IL-1β (1:1000, ab254360, Abcam), and anti-TAF15 (1:10000, ab134916).

Immunofluorescence staining

After 15 min of fixation in 10% formalin, HL-1 cells were incubated with PBS containing 5% BSA for 1 h, followed by overnight incubation with with primary antibody against AIM2 (1:100, ab93015, Santa Cruz Biotechnology) at 4 °C. For immunofluorescence staining, the cells were then incubated with secondary antibodies with Alexa Fluor® 488 (anti-mouse IgG, 1:100, sc-516248, Santa Cruz Biotechnology) for 1 h at RT. DAPI was used as a control for staining the nucleus. The FV-1200 laser scanning confocal microscope was used for visualization and the results were analyzed by Image J.

RNA-pull down

RNA pull-down was performed to analyze the interplay between MEG3 and TAF15, or AIM2 mRNA and TAF15. Biotin-labeled MEG3 and AIM2 were designed and provided by GenePharm (Shanghai, China). Biotin-labeled MEG3 and AIM2 or their anti-sense RNAs were transcribed and purified, followed by mixing and incubating with the cell lysates overnight. Then, streptavidin-conjugated magnetic beads (Invitrogen) were added and allowed for another 2 h incubation. Beads were then washed thoroughly, and the retrieved proteins were examined using western blot.

RNA immunoprecipitation (RIP)

RIP assay was conducted to analyze the interplay between MEG3/TAF15 and AIM2 mRNA/TAF15 using the Magna RIP kit (EMD Millipore, USA). Cells were harvested and lysed in the complete RIP lysis buffer. Then, lysate was incubated with magnetic beads conjugated with anti-TAF15 or IgG (used as control). Co-precipitated RNAs were extracted, enriched and detected using RT-qPCR. Total RNAs (input control) were also detected.

FISH and immunofluorescence (IF) double staining

The MEG3 and TAF15 FISH probes were designed and supplied by Genema (Shanghai, China). Cells were seeded on coverslips and allowed to growth for 24 h, followed by the fixation with 4% paraformaldehyde. Next, cells were incubated with the MEG3 or TAF15 probe (1: 50) overnight in PBS containing 0.5% Triton X-100, blocked with 0.07% streptavidin solution. Afterwards, the cells were incubated with anti-TAF15 (1:500, ab134916, Abcam) overnight, followed by the incubation with Alexa Fluor 594 conjugated secondary antibody for 2 h and stained with 4′, 6-diamidino-2-phenylindole (DAPI). Signals were observed under a confocal microscope (Olympus, Japan).

Statistical analysis

All data were shown as mean ± SEM. Statistical analysis of the results was performed by a student’s t-test (two groups) or one-way ANOVA (multiple groups). P < 0.05 was regarded as statistically significant.