1. INTRODUCTION

Multipotent mesenchymal stem cells (MSCs) are considered to be ideal sources of stem cells for tissue regeneration because of their high proliferation ability and potential to differentiate into multiple cell types.1 These cells can be obtained from various sources, such as adipose tissue, bone marrow, and umbilical cords.2 Adipose-derived mesenchymal stem cells (ADSCs) and umbilical cord-derived mesenchymal stem cells (UCSCs) are particularly attractive for tissue engineering applications, as they can be collected through less invasive methods. ADSCs, which have ability to differentiate into multiple cell lineages, can be easily obtained in large quantities through liposuction and are readily cultured.3 UCSCs, which can be obtained from umbilical cords that are typically considered medical waste, also possess the ability to differentiate into multiple cell lineages.4,5

UCSCs are derived from the umbilical cord matrix surrounding the vessels and are classified as mesenchymal lineage cells.6 These cells have a short doubling time and their collection dose not present ethical limitations.7 Furthermore, there are no medical or legal restrictions on the use of UCSCs in various applications.8 Previous studies have reported that UCSCs have the longest culture period, with up to nine passages (P9), compared to six passages (P6) for bone marrow-derived mesenchymal stem cells (BMSCs) and ADSCs, and also exhibit the highest proliferation capacity.2 Although UCSCs have the potential to differentiate into multiple cell types, their differentiation tendency leans towards the osteogenic lineage.8

One of the issues that may affect the biological properties of MSCs is aging. Biologically aged MSCs release reactive oxygen species (ROS) that cause oxidative stress in the surrounding environment. This stress can lead to the growth arrest of senescent cells and cause neighboring cells to enter a senescent state.9,10 Replicative senescence of MSCs can affect cell behavior and regenerative capacity.2,11 Studies have observed an age-related decline in the number of cells and proliferative capacity of BMSCs from donors of varying ages.12 Additionally, the proliferation, viability, and differentiation potential of MSCs from aged donors are reduced when compared to those from younger ones.13 Cellular senescence results in ROS accumulation, upregulation of tumor suppressor genes, telomere shortening, growth arrest, morphological changes in cells, and an increase in senescence-associated β-galactosidase (SA-β-gal) expression.14

Infant ADSCs can be isolated from excised polydactyly fat tissue, which is often discarded as surgical waste. The prevalence of polydactyly in Taiwan was 16.57 per 10 000 births between 2005 and 2014, with males being twice as likely to be affected as females.15–17 Both infant ADSCs and UCSCs can be obtained from surgical waste and expanded in vitro to obtain large numbers of cells for experiments. Previous studies have shown that infant ADSCs exhibit less senescence and replicative stress than adult ADSCs and have better proliferation abilities, antioxidant defense, and the potential for chondrogenic, adipogenic, and neurogenic differentiation.18 On the other hand, UCSCs are considered to be among the youngest MSCs. In this study, three UCSC cell lines were purchased from American Type Culture Collection (ATCC), with different races and genders represented in each cell line. The aim of this study is to compare the proliferation, antioxidative ability, and differentiation potential of infant ADSCs and UCSCs.

2. METHODS 2.1. Isolation and culture of UCSCs and infant ADSCs

UCSC cell lines (ATCC PCS-500-010) were purchased from ATCC (Manassas, VA, USA), and included UCSC-1 (lot number 64310874) at passage 1, UCSC-2 (lot number 70005074) at passage 2, and UCSC-3 (lot number 70014369) at passage 2.

To isolate the infant ADSCs (n = 3), the fat tissue was extracted from excised redundant thumbs or fingers of children with polydactyly after surgical reconstruction. The cases of polydactyly were sporadic without other systemic problems. The Institutional Review Board (IRB) approved the protocol and procedure. The fat sample was incubated in 0.1% collagenase (Wako, Osaka, Japan) in Hank’s balanced salt solution (HBSS; Gibco, Carlsbad, CA, USA) for digestion in a shaking water bath (37°C, 30 minutes). After digestion, the stromal vascular fraction (SVF) cells were washed with PBS three times to remove the collagenase.18 The cells were isolated and resuspended in culture medium at a concentration of approximately 2–3 × 106 cells per 10cm2 dish.

The cells were seeded at a density of 1 × 105 cells in a 60-cm2 dish and cultured in the Dulbecco’s Modified Eagle Media (DMEM; Gibco) with low glucose (LG-DMEM), 10% fetal bovine serum (FBS; Invitrogen, Carlsbad, CA, USA), and antibiotic-antimycotic solution (Corning Life Science, Corning, NY, USA). The culture medium was changed every 2 days, and confluent cells (at a density of approximately 1 × 106 cells in a 60-cm2 dish) were propagated at a 1:5 split every 5 to 7 days. The cells were cultured at 37°Cand 5% CO2.

2.2. Doubling time quantification

The UCSCs and infant ADSCs were cultured in DMEM containing 10% FBS, 100 U/mL penicillin (Invitrogen), 100 μg/mL streptomycin (Invitrogen), and 250 ng/mL amphotericin B (Invitrogen). The culture medium was changed every 3–4 days.18,19

To calculate the population doubling time, the cells were seeded at a density of 1–2 × 105 cells in a 10-cm dish, recovered, and passaged every 7 days. The cell numbers at each passage were counted to determine the fold changes in cell numbers. This process was carried out in triplicate culture.20

2.3. Quantitative reverse transcription polymerase chain reaction analysis

Cellular RNA was extracted using Trizol reagent (Invitrogen). Random sequence primers and the iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA) were used to synthesize the first strand complement DNA (cDNA). Real-time polymerase chain reaction (PCR) was performed to amplify the cDNA in a reaction mixture containing specific primer pairs (listed in the Table 1) and the fast SYBR Green 189 Master Mix (Applied Biosystems, Foster City, CA, USA). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control. Analysis of the results was carried out using the software supplied with the StepOne (Applied Biosystems), and the comparative CT (ΔΔCT) method.20

Table 1 - Primers used for RT-qPCR analysis Gene Forward primer (5′-3′) Reverse primer (5′-3′) p16 ATCATCAGTCACCGAAGG TCAAGAGAAGCCAGTAACC p21 CATCTTCTGCCTTAGTCTCA CACTCTTAGGAACCTCTCATT p53 CGGACGATATTGAACAATGG GGAAGGGACAGAAGATGAC SOD1 GTGATTGGGATTGCGCAGTA TGGTTTGAGGGTAGCAGATGAGT SOD2 TTAACGCGCAGATCATGCA GGTGGCGTTGAGATTGTTCA SOD3 CATGCAATCTGCAGGGTACAA AGAACCAAGCCGGTGATCTG SOX9 CCAGGGCACCGGCCTCTACT TTCCCAGTGCTGGGGGCTGT COL2 TTCAGCTATGGAGATGACAATC AGAGTCCTAGAGTGACTGAG COL10 CAAGGCACCATCTCCAGGAA AAAGGGTATTTGTGGCAGCATATT RUNX2 ATGACGTCCCCGTCCATCCA GGAAGGCCAGAGGCAGAAGTCA ALP ACCATTCCCACGTCTTCACATTTG AGACATTCTCTCGTTCACCGCC PPARγ TCAGGTTTGGGCGGATGC TCAGCGGGAAGGACTTTATGTATG LPL TGTAGATTCGCCCAGTTTCAGC AAGTCAGAGCCAAAAGAAGCAGC ALB TGCTTGAATGTGCTGATGACAGGG AAGGCAAGTCAGCAGGCATCTCATC TAT TCAGTTTCCCGTATGCCACC ATCTTTGGGGGCTTGGATGG MMP3 CTGTTGATTCTGCTGTTGAG AAGTCTCCATGTTCTCTAACTG DCN CTCTGCTGTTGACAATGGCTCTCT TGGATGGCTGTATCTCCCAGTACT COL3 GGGAACATCCTCCTTCAACA GCAGGGAACAACTTGATGGT GADPH ATATTGTTGCCATCAATGACC GATGGCATGGACTGTGGTCATG

ALB = albumin; ALP = alkaline phosphatase; COL2 = collagen type 2; COL3 = collagen type 3; COL10 = collagen type 10; DCN = decorin; GAPDH = glyceraldehyde-3-phosphate dehydrogenase; LPL = lipoprotein lipase; MMP3 = matrix metallopeptidase 3; p16 = cyclin-dependent kinase inhibitor 2A (CDKN2A); p21 = cyclin-dependent kinase inhibitor 1A (CDKN1A); p53 = tumor protein p53; PPARγ = peroxisome proliferator-activated receptor γ; RUNX2 = runt-related transcription factor 2; SOD1 = superoxide dismutase type 1; SOD2 = superoxide dismutase type 2; SOD3 = superoxide dismutase type 3; SOX9 = SRY-box containing gene 9; TAT = tyrosine aminotransferase.

2.4. SA-β-gal assays

To evaluate the cell senescence, a senescence β-galactosidase cell staining kit (Cell Signaling Technology, Danvers, MA, USA) was used to assay the UCSCs and infant ADSCs. Cells at passages 6–7 were seeded at a density of 1 × 105 cells per 6-cm dish and cultured for 5 days at 37°Cand 5% CO2. The senescent cells were detected by staining in blue following the manufacturer’s instructions. The stained cells were observed under a microscope.

2.5. Phosphorylated histone variant H2AX immunostaining

To perform phosphorylated histone variant H2AX (γH2AX) immunostaining, UCSCs and infant ADSCs at passage 3 were permeabilized with a permeabilization buffer (0.1% Triton X-100 in PBS) and fixed with 4% paraformaldehyde. The cells were then stained with primary antibodies (tcba13051; Taiclone Biotech Corp., Taipei, Taiwan) against the phosphorylation of the histone variant, γH2AX, at an appropriate dilution. The DyLight 488-conjugated goat anti-rabbit IgG secondary antibodies (GTX213110-01; GeneTex Inc., Irvine, CA, USA) were used to show green fluorescence. The nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI; F6057; Sigma-Aldrich, St Louis, MO, USA). Fluorescence intensity was determined by analyzing 60 to 100 cells using Image-Pro Plus (v4.5.0.29; Media Cybernetics, Silver Spring, MD, USA). The intensity values were normalized with the cell numbers and reported in arbitrary units.

2.6. Chondrogenic differentiation

To induce chondrogenic differentiation, UCSCs or infant ADSCs at passages 3 to 5 were cultured in a chondrogenic differentiation medium (CIM), consisting of serum-free and high-glucose (4.5 g/L) DMEM (HG-DMEM) (Gibco) supplemented with 50 mg/mL insulin-transferrin-selenium (ITS) plus Premix (BD Biosciences, San Jose, CA, USA), 10–7 M dexamethasone (Sigma-Aldrich), 50 mg/mL ascobate-2-phosphate (Sigma-Aldrich), and 10 ng/mL TGF-β1 (R&D Systems, Minneapolis, MN, USA). The cells were cultured at 37°C and 5% CO2, with the medium being changed every 3 days. On day 21 of induction, the pellets were observed and collected for further analysis.21

2.7. Immunohistochemistry staining of the chondrogenic pellets and quantification

The equivalent diameter of the chondrogenic pellets formed by UCSCs and infant ADSCs was measured on day 21. The pellets were embedded in paraffin, sectioned, and stained with Alcian blue (ANC500; ScyTek Laboratories, Logan, UT, USA) to detect proteoglycans. Nuclear fast red staining (NFS125; ScyTek) was used to counterstain the nuclei. To detect collagen (COL) 2 and 10, the sections were deparaffinized, hydrated, and treated with 0.4 mg/mL proteinase K for 15 minutes. Endogenous peroxidase activity was blocked with 3% hydrogen peroxide (Sigma-Aldrich). The sections were then incubated with primary antibodies against COL2 (MAB8887; Millipore Corporation, Burlington, MA, USA) or COL10 (ab58632; Abcam, Cambridge, MA, USA) overnight at 4°C. The samples were incubated with the secondary anti-rabbit polymer-horseradish peroxidase (HRP) in the Super Sensitive Polymer-HRP Detection Systems (QD420-YIKE; BioGenex, San Ramon, CA, USA) for 30 minutes. Staining was visualized with the DAB substrate and hematoxylin. The staining intensities in the areas of the infant ADSC- and UCSC-differentiated pellets were quantified using image analysis software (Image Pro Plus 4.0; Media Cybernetics, Inc., Rockville, MD, USA), and the values were compared to calculate the relative fold.

2.8. Osteogenic differentiation

The UCSCs and infant ADSCs at passages 3 to 5 were induced in an osteogenic induction medium (OIM) which was used to induce osteogenic differentiation; it was a LG-DMEM supplemented with 10% FBS, 50 μg/mL ascorbic acid-2 phosphate (Nacalai, Kyoto, Japan), 0.01 μM dexamethasone (Sigma-Aldrich), and 1 mM β-glycerol phosphate (Sigma-Aldrich) and maintained at 37°C and 5% CO2 for 21 days.

2.9. Alizarin Red S staining

Alizarin Red S (ARS) staining is a widely used method for detecting calcium deposition in cells undergoing osteogenic differentiation. In this study, the differentiated cells were fixed and stained with ARS (A5533; Sigma-Aldrich) after 21 days of osteogenic differentiation. The stained cells were then subjected to a quantification assay to determine the extent of osteogenic differentiation. The ARS was extracted from the stained cells using a 10% cetylpyridinium chloride buffer (CPC), and the optical density (OD) of the extract was measured at 550 nm using an enzyme-linked immunosorbent assay (ELISA) reader (Spectra MAX 250; Molecular Devices, Sunnyvale, CA, USA). The OD of differentiated cells was normalized with that of undifferentiated cells, and the relative fold changes were calculated to determine the degree of osteogenic differentiation induced in the UCSCs and infant ADSCs.

2.10. Adipogenic differentiation

To induce adipogenic differentiation, UCSCs and infant ADSCs at passages 3 to 5 were treated with an adipogenic induction medium (AIM) containing LG-DMEM supplemented with 10% FBS, 50 μg/mL ascorbic acid-2 phosphate, 0.1 μM dexamethasone, 50 μM indomethacin (Sigma-Aldrich), 45 μM 3-isobutyl-1-methylxanthine (Sigma-Aldrich), and 1 μg/mL insulin (Sigma-Aldrich). The cells were incubated at 37°C and 5% CO2 for 21 days.

2.11. Oil Red O staining

The differentiated cells were washed twice with PBS, fixed in 10% formalin for at least 1 hour at room temperature, and stained with Oil Red O (O9755; Sigma-Aldrich) for 2 hours to visualize adipogenic differentiation. The working solution of Oil Red O was prepared by mixing 15 mL of a stock solution (0.5% in isopropanol) and 10 mL of distilled water and then filtering through a polyvinylidene difluoride (PVDF) membrane (0.2 µm). Quantification of lipid accumulation was performed by extracting Oil Red O from the stained cells with isopropanol, and the OD of the extract was measured at 510 nm using an ELISA reader (Spectra MAX 250; Molecular Devices). The OD of differentiated cells was normalized to that of undifferentiated cells, and the relative fold changes were reported.

2.12. Hepatogenic differentiation

The UCSCs and infant ADSCs were induced in a stepwise induction protocol. In step 1, cells were treated with LG-DMEM containing 20 ng/mL human epidermal growth factor (hEGF; Sigma-Aldrich) and a 10 ng/mL human fibroblast growth factor-basic (hBFGF; Sigma-Aldrich) at 37°C and 5% CO2 for 24 hours. In step 2, the differentiation was treated with LG-DMEM supplemented with the 20 ng/mL human hepatocyte growth factor (hHGF; Sigma-Aldrich), 10 ng/mL hBFGF, and 0.61 mg/mL Nicotinamide (Sigma-Aldrich) for 7 days. In step 3, the cells were induced with LG-DMEM supplemented with 20 ng/mL Oncostatin (R&D Systems), 10–6 M Dexamethasone (Sigma-Aldrich), and ITS-premix (Corning Life Science) for 7 days.22 The total process of differentiation lasted 15 days.

2.13. Immunofluorescence staining of the hepatogenic differentiated cells and quantification

On day 15, differentiated cells were fixed and stained with a primary antibody against albumin (Taiclone Biotech Corp., Taipei, Taiwan), followed by incubation with DyLight 488-conjugated goat anti-mouse IgG (A90-516D2; Bethyl Laboratories, Inc., Montgomery, TX, USA) secondary antibodies. The slides were counterstained with DAPI for nuclear staining. Immunofluorescence intensity was quantified using Image-Pro Plus v4.5.0.29.

2.14. Tenogenic differentiation

The UCSCs and infant ADSCs at passages 3 to 5 were induced in a tenogenic induction medium (TIM), containing LG-DMEM with 10% FBS, 50 μg/mL ascorbic acid (AA; Sigma Aldrich), and 100 ng/mL connective tissue growth factor (CTGF),23 and maintained at 37°C and 5% CO2 for 21 days.

2.15. Picrosirius red staining

Collagen deposition of the differentiated cells was evaluated using picrosirius red staining. The cells were seeded in a 24-well plate (Corning Life Science) at a density of 3 × 103 cells/cm2, fixed in Bouin’s solution (Bouin’s Fixative; Electron Microscopy Sciences, Hatfield, PA, USA) for 1 hour, and stained with 0.1% picrosirius red (ScyTek Laboratories) saturated in picric acid (Sigma-Aldrich). Collagen deposition was visualized under polarized light microscopy.24 Quantification of the stained collagen was detected by extracting the picrosirius red from the stained cells with a 0.2 M NaOH and methanol (1:1) buffer, and the OD of the extract was measured at 550 nm using an ELISA reader (Spectra MAX 250; Molecular Devices).

2.16. Statistical analysis

The quantitative data were presented as mean ± SD, and statistical analysis was performed using Prism (version 5.03; GraphPad, La Jolla, CA, USA). The Mann-Whitney U test was used to verify the statistical significance of the experimental results, and p values of less than 0.05 were considered significant.

3. RESULTS 3.1. Proliferation of the infant ADSCs and UCSCs

The morphologies and confluence of infant ADSCs and UCSCs at passages 2 and 7 were imaged (Fig. 1A). The proliferation of infant ADSCs and UCSCs from passages 2 to 8 was monitored by measuring the fold increases in the cell numbers (Fig. 1B) and the cell doubling time (Fig. 1C). The fold increases in cell numbers of infant ADSCs at passages 2 (a 33.74- ± 4.74-fold increase) and 3 (a 27.76- ± 5.04-fold increase) was significantly higher than that of UCSCs (a 7.93- ± 0.66-fold increase and a 16.66- ± 1.93-fold increase, respectively). The doubling time of infant ADSCs at passages 2 (1.1 ± 0.15 days), 7 (1.75 ± 0.10 days), and 8 (1.81 ± 0.05 days) were also significantly shorter than that of UCSCs (2.02 ± 0.08 days, 2.53 ± 0.43 days, and 2.49 ± 0.06 days, respectively). These results suggest that UCSCs require an activation period (P2–P3) to achieve their full proliferative potential, after which their proliferation declines. In contrast, the proliferation of infant ADSCs declined in every passage, indicating the culture caused rapid senescence. However, the preservation of the proliferation trend in infant ADSCs was better than that in UCSCs.

Fig. 1:

Proliferation of the UCSCs and infant ADSCs. A, The morphology of UCSCs and infant ADSCs at passages 2 and 7 was observed using a phase contrast microscope (Nikon eclipse TS100) with a magnification of ×40. The scale bar represents 100 μm (B) the fold increases in cell numbers and (C) doubling time periods of UCSCs and infant ADSCs were calculated and compared from passages 2 (P2) to 8 (P8). The mean ± SEM with multiple experimental replicates is shown. The statistical significance of comparison between UCSCs and infant ADSCs was determined by the Mann-Whitney U test analysis. The symbol “**” indicates p < 0.01, and the symbol “***” indicates p < 0.001. ADSCs = adipose-derived mesenchymal stem cells; UCSCs = umbilical cord-derived mesenchymal stem cells.

3.2. Senescence, replicative stress, and anti-oxidative ability in the infant ADSCs and UCSCs

The expression of aging-related genes, including cyclin-dependent kinase inhibitor 2A (CDKN2A, p16) and cyclin-dependent kinase inhibitor 1A (CDKN1A, p21), was significantly higher in the UCSCs at early passages (P3–P5) compared to the infant ADSCs (Fig. 2A). The expression of the p53 gene in the infant ADSCs was higher than that in the UCSCs, but the difference was not significant. SA-β-gal staining at passage 7 showed more positive staining in the UCSCs than in the infant ADSCs (Fig. 2B). Additionally, immunofluorescence staining of γH2AX in the nuclei of the infant ADSCs and UCSCs showed that there were fewer fluorescent signals in the infant ADSCs than in the UCSCs (Fig. 2C, D). Furthermore, the levels of the SODs were measured. The expression levels of SOD1 (a 2.81- ± 0.01-fold increase) (Fig. 3A), SOD2 (a 9.44- ± 0.19-fold increase) (Fig. 3B), and SOD3 (a 166- ± 0.04-fold increase) (Fig. 3C) were all significantly higher in the infant ADSCs than in the UCSCs. These results suggest that infant ADSCs have better anti-oxidative ability than the UCSCs.

Fig. 2:

Senescence and replicative stress in UCSCs and infant ADSCs. A, RT-qPCR analysis of senescence related-genes, including P16, P21, and P53, in UCSCs and infant ADSCs at passages 3–5. The values were normalized to the expression of GAPDH, and the relative fold changes were compared to UCSCs. Statistical significance of comparing UCSCs and infant ADSCs was determined by the Mann-Whitney U test. B, SA-β-gal staining of UCSCs and infant ADSCs and UCSCs at passage 7 was detected by a Senescence Detection Kit using a Nikon eclipse TS100 microscope. Blue-stained cells indicate positive SA-β-gal staining. Positive was stained and exhibited in blue. The left panel showed the cell image at ×40 magnification (the scale bar = 100 μm), and the right panel showed the cell image at ×200 magnification (the scale bar = 100 μm). C, Immunostaining of γH2AX (green) and DAPI (blue) in UCSCs and infant ADSCs at passage 3, detected by an Olympus BX43 microscope (magnification ×400, the scale bar = 100 μm). D, Quantification of γH2AX immunofluorescence intensity in the nuclei in the UCSCs and infant ADSCs. Values, which quantified by the Image-Pro Plus v4.5.0.29, were normalized to the cell numbers and compared to show the relative fold changes. Mean ± SEM with three replicates were expressed. Statistical significance of comparing infant ADSCs and UCSCs was determined by the Mann-Whitney U test. “**” represented p < 0.01. ADSCs = adipose-derived mesenchymal stem cells; DAPI = 4′,6-diamidino-2-phenylindole; GAPDH = glyceraldehyde-3-phosphate dehydrogenase; RT-qPCR = reverse transcription-quantitative polymerase chain reaction; SA-β-gal = senescence-associated β-galactosidase; UCSCs = umbilical cord-derived mesenchymal stem cells; γH2AX = phosphorylated histone variant H2AX.

Fig. 3:

SOD expression levels in UCSCs and infant ADSCs. A, The SOD1, (B) SOD2, and (C) SOD3 genes of the UCSCs and infant ADSCs were detected by RT-qPCR, and the values were normalized to the expression of GAPDH. The value of the UCSCs was used as the standard to compare with that of the infant ADSCs, and the relative fold changes were shown. Mean ± SEM with three experimental replicates were expressed. Statistical significance of comparing the infant ADSCs and UCSCs was determined by the Mann-Whitney U test. “*” represented p < 0.05. “***” represented p < 0.001. ADSCs = adipose-derived mesenchymal stem cells; GAPDH = glyceraldehyde-3-phosphate dehydrogenase; RT-qPCR = reverse transcription-quantitative polymerase chain reaction; SOD = superoxide dismutase; UCSCs = umbilical cord-derived mesenchymal stem cells.

3.3. Chondrogenic differentiation in the infant ADSCs and UCSCs

Chondrogenic differentiation was observed in both infant ADSCs and UCSCs, but the infant ADSCs were found to differentiate larger chondrogenic pellets compared to the UCSCs (Fig. 4A). The mean diameters of the differentiated pellets from the infant ADSCs were about 0.2 cm (0.2 ± 0.06 cm), which was significantly larger than the UCSC-differentiated pellets, with a mean diameter of about 0.15 cm (0.14 ± 0.03 cm) (Fig. 4B). The SOX9 gene expression, an early marker of chondrogenic differentiation, in the chondrogenic pellets differentiated from infant ADSCs on day 7, showed a 32.66- ± 17.55-fold increase compared to the control group. This increase was similar to the pellets formed from the UCSCs (a 31.83- ± 18.59-fold increase) (Fig. 4C). Late markers, such as collagen type 2 (COL2) and collagen type 10 (COL10) expression, had significantly higher fold increase in the infant ADSC-differentiated chondrogenic pellets (an 1825- ± 1026-fold increase and a 3565.2- ± 1451-fold increase, respectively) compared to those formed from the UCSCs (a 91.7- ± 61.25-fold increase and a 51.13- ± 22.35-fold increase, respectively) (Fig. 4D, E). The contents of glycosaminoglycans (GAGs) of infant ADSC- and UCSC-differentiated pellets were stained by Alcian blue, and the fold changes of the expression of the COL2 and COL10 protein were analyzed by immunohistochemistry staining (Fig. 5A; Fig. S1, https://links.lww.com/JCMA/A210). The intensities of the blue color of the infant ADSC-generated chondrogenic pellets stained by Alcian blue were similar to those of the UCSCs (Fig. 5B). The measured intensities of the UCSCs-generated pellets were set as the standard to calculate the fold changes of the infant ADSC-generated pellets (a 1.04- ± 0.11-fold increase). Both the fold changes of the expression of COL2 and COL10 in the pellets formed from the infant ADSCs (a 1.78- ± 0.22-fold increase and a 1.41- ± 0.11-fold increase, respectively) were significantly higher than those formed from the UCSCs (Fig. 5C, D).

Fig. 4:

In vitro chondrogenic differentiation of UCSCs and infant ADSCs. A, The chondrogenic pellets differentiated from passages 3 to 5 of the UCSCs and infant ADSCs (3 × 105 cells/pellet) on day 21 (the scale bar = 1 mm). B, The diameters of the pellets was measured on day 21. The expression levels of (C) SOX9 on day 7, (D) COL2, and (E) COL10 on day 21 of the UCSC- and infant ADSC-differentiated pellets were detected by RT-qPCR. The values were normalized to the expression of GAPDH. The gene expression of the undifferentiated cells was used as the standard to compare with that of the UCSC- and infant ADSC-differentiated chondrocyte-like cells, and the relative fold changes were shown. Mean ± SEM with three experimental replicates were expressed. Statistical significance of comparing the infant ADSCs- and UCSCs-differentiated pellets was determined by the Mann-Whitney U test. “*” represented p < 0.05. ADSCs = adipose-derived mesenchymal stem cells; CIM = chondrogenic differentiation medium; COL = collagen; GAPDH = glyceraldehyde-3-phosphate dehydrogenase; RT-qPCR = reverse transcription-quantitative polymerase chain reaction; SOX9 = SRY-box containing gene 9; UCSCs = umbilical cord-derived mesenchymal stem cells.

Fig. 5:

Immunohistochemistry staining of UCSC- and infant ADSC-differentiated pellets. A, The pellets of the 21-d chondrogenic differentiated UCSCs and infant ADSCs were sectioned and stained with Alcian blue, anti-COL2, and anti-COL10 antibodies to detect the protein expression levels by immunostaining and evaluated by an Olympus BX43 microscope (magnification ×100, the scale bar = 200 μm). B–D, The intensities of each staining were measured and normalized with the whole backgrounds of the sections. The value of the UCSCs was used as the standard to compare with that of the infant ADSCs, and the relative fold changes were shown. Mean ± SEM with three experimental replicates were expressed. Statistical significance of comparing the UCSC- and infant ADSC-differentiated pellets was determined by the Mann-Whitney U test. “*” represented p < 0.05. “**” represented p < 0.01. ADSCs = adipose-derived mesenchymal stem cells; COL2 = collagen type 2; COL10 = collagen type 10; UCSCs = umbilical cord-derived mesenchymal stem cells.

3.4. Osteogenic differentiation in the infant ADSCs and UCSCs

To assess the osteogenic differentiation of infant ADSCs and UCSCs, the fold changes in the expression of the osteocyte-related gene were measured after 21 days of differentiation. The relative expression fold changes of two important genes, runt-related transcription factor 2 (RUNX2) (Fig. 6A) and alkaline phosphatase (ALP) (Fig. 6B), were significantly higher in the infant ADSC-differentiated osteogenic cells, with a 5.52- ± 0.59-fold increase and a 45.06- ± 14.14-fold increase, respectively, compared to UCSC-differentiated cells, which showed only a 1.33- ± 0.25-fold increase and a 10.3- ± 2.77-fold increase, respectively. The calcium deposits in the infant ADSC- and UCSC-differentiated osteogenic cells on day 21 were stained by ARS to determine the degrees of osteogenic differentiation (Fig. 6C). Calcium deposits in the differentiated cells stained with ARS to determine the degree of osteogenic differentiation (Fig. 6C), and the intensity of staining was measured. The differentiated cells showed obvious red color compared to the undifferentiated cells (Fig. 6C; Fig. S2, https://links.lww.com/JCMA/A210). The intensity of ARS staining in infant ADSC-differentiated cells (a 32.14- ± 0.74-fold increase) was significantly higher than that in UCSC-differentiated cells (a 2.3- ± 0.25-fold increase) (Fig. 6D).

Fig. 6:

In vitro osteogenic differentiation of UCSCs and infant ADSCs. Osteocyte-related genes, including the RUNX2 (A) and ALP (B) of the UCSCs and infant ADSCs after having been treated with the factor-induced medium (OIM) for 21 d, were detected by RT-qPCR. The expression value of each gene was normalized to the expression of GAPDH. The gene expression of the undifferentiated cells was used as the standard to compare with that of the UCSC- and infant ADSC-differentiated osteocyte-like cells, and the relative fold changes were shown. C, The undifferentiated UCSCs and infant ADSCs used as the controls were stained with ARS. The 21-d osteogenic differentiated UCSCs and infant ADSCs were confirmed with the ARS staining and detected by a Nikon eclipse TS100 microscope (magnification ×200, the scale bar = 25 μm). D, The ARS staining were extracted from the stained cells and measured the OD at wavelength of 550 nm. The OD of differentiated cells was normalized with that of controls and the relative fold changes were shown. Mean ± SEM with three experimental replicates were expressed. Statistical significance of comparing the UCSC- and infant ADSC-differentiated osteogenic cells was determined by the Mann-Whitney U test. “*” represented p < 0.05. ADSCs = adipose-derived mesenchymal stem cells; ALP = alkaline phosphatase; ARS = Alizarin Red S; GAPDH = glyceraldehyde-3-phosphate dehydrogenase; OD = optical density; OIM = osteogenic induction medium; RT-qPCR = reverse transcription-quantitative polymerase chain reaction; RUNX2 = runt-related transcription factor 2; UCSCs = umbilical cord-derived mesenchymal stem cells.

3.5. Adipogenic differentiation in the infant ADSCs and UCSCs

Adipogenic differentiation was investigated in infant ADSCs and UCSCs by detecting the expression of peroxisome proliferator-activated receptor γ (PPARγ) (Fig. 7A) and lipoprotein lipase (LPL) (Fig. 7B) genes on day 21. The fold changes in the expression levels of both genes were higher in the infant ADSC-differentiated adipogenic cells (a 48.8- ± 18.84-fold increase and a 70.82- ± 11.57-fold increase, respectively) than in the UCSC-differentiated cells (a 29.03- ± 6.74-fold increase and a 7.82- ± 2.12-fold increase, respectively), but the difference in PPARγ expression was not significant. Oil Red O staining of the lipids in the adipogenic cells that differentiated from the infant ADSCs and UCSCs on day 21 shows red color compared to undifferentiated cells (Fig. 7C; Fig. S3, https://links.lww.com/JCMA/A210). The intensity of the Oil Red O staining was significantly higher in the infant ADSC-differentiated cells (a 5.27- ± 0.21-fold increase) than in the UCSC-differentiated cells (a 1.3- ± 0.10-fold increase) (Fig. 7D).

Fig. 7:

In vitro adipogenic differentiation of UCSCs and infant ADSCs. Adipose-related genes, including PPARγ (A) and LPL (B) of the UCSCs and infant ADSCs after having been treated with the factor-induced medium (AIM) for 21 d, were detected by RT-qPCR. The expression value of each gene was normalized to the expression of GAPDH. The gene expression of the undifferentiated cells was used as the standard to compare with that of the UCSC- and infant ADSC-differentiated adipocyte-like cells, and the relative fold changes were shown. C, The undifferentiated UCSCs and infant ADSCs used as the controls were stained with Oil Red O. The 21-d adipogenic differentiated UCSCs and infant ADSCs were confirmed with the Oil Red O staining and detected by a Nikon eclipse TS100 microscope (magnification ×200, the scale bar = 25 μm). D, The Oil Red O staining were extracted from the stained cells and measured the OD at wavelength of 510 nm. The OD of differentiated cells was normalized with that of undifferentiated cells and the relative fold changes were shown. Mean ± SEM with three experimental replicates were expressed. Statistical significance of comparing the UCSC- and infant ADSC-differentiated adipogenic cells was determined by the Mann-Whitney U test. “*” represented p < 0.05. ADSCs = adipose-derived mesenchymal stem cells; AIM = adipogenic induction medium; GAPDH = glyceraldehyde-3-phosphate dehydrogenase; LPL = lipoprotein lipase; OD = optical density; PPARγ = peroxisome proliferator-activated receptor-γ; RT-qPCR = reverse transcription-quantitative polymerase chain reaction; UCSCs = umbilical cord-derived mesenchymal stem cells.

3.6. Hepatogenic differentiation in the infant ADSCs and UCSCs

The expression levels of albumin (ALB) and tyrosine aminotransferase (TAT), which are markers for hepatogenic differentiation, were measured in the infant ADSC-differentiated and UCSC-differentiated cells. The results showed that the fold changes in ALB expression (Fig. 8A) and TAT expression (Fig. 8B) were significantly higher in infant ADSCs (a 7.97- ± 1.35-fold increase and a 3.53- ± 0.23-fold increase, respectively) compared to UCSC (a 3.48- ± 0.94-fold increase and a 1.69- ± 0.49-fold increase, respectively). To further confirm these finding, albumin expression was detected using immunofluorescence staining (Fig. 8C; Fig. S4, https://links.lww.com/JCMA/A210). The quantified albumin expression in infant ADSC-differentiated hepatogenic cells (a 9.18- ± 1.06-fold increase) was significantly higher than that in UCSC-differentiated ones (a 2.72- ± 0.54-fold increase) (Fig. 8D).

Fig. 8:

In vitro hepatogenic differentiation of UCSCs and infant ADSCs. Hepatocyte-related genes, including matrix ALB (A) and TAT (B) of the UCSCs and infant ADSCs after having been treated with the HIM for 13–15 d, were detected by RT-qPCR. The expression value of each gene was normalized to the expression of