MaterialsExperimental animals

SPF -grade healthy male C57BL/6 J mice, 6–8 weeks old, were purchased from the Animal Experiment Center of Guangzhou University of Traditional Chinese Medicine, license number: SCXK (Guangdong) 2018–0034. They were kept in the Animal Center of the First Affiliated Hospital of Guangzhou University of Traditional Chinese Medicine and given free access to food and water. Experiments were started after one week of adaptive feeding. All animal experiments in this experiment complied with the requirements of the Animal Experiment Ethics Committee. It has passed the ethical review of experimental animals in the First Affiliated Hospital of Guangzhou University of Traditional Chinese Medicine, number: GZTCMF1-2,022,122.

Main experimental reagents and instruments

FITC Anti Mouse F4/80 and APC Anti Mouse CD86 were purchased from e Bioscience Company in the United States, PE Anti Mouse CD206 was purchased from Biolagend Company in the United States, PBS was purchased from Thermo Fisher Company in the United States; red blood cell lysate was purchased from Beijing Soleil Bao Biotechnology Company; 200 -mesh cell screen and 50 ml centrifuge tube were purchased from Zhejiang Shuohua Biotechnology Company; flow cytometry tubes were purchased from BD Company in the United States; CORT E lisa kit was purchased from Cayman Company in the United Kingdom; TRI zol reagent was purchased from From Invitrogen, USA; E vo M -MLV reverse transcription kit II, SYBR Green Pro Taq HS premixed type qPCR kits and ROX dyes were purchased from Hunan Aikerui Company; primers were provided by Shanghai Bioengineering Company; RIPA lysate ( enhanced), BCA protein quantification kit ( enhanced), Loading Buffer All provided by Shanghai Biyuntian Company; rabbit source Anti Mouse NF -κB P65 primary antibody, rabbit source Anti Mouse NF-κB p P65 primary antibody, rabbit source Anti Mouse IKB-α primary antibody, rabbit source Anti Mouse p IKB-α primary antibody was purchased from Abcam company in the UK, rabbit source Anti Mouse The α—tubulin primary antibody and the rabbit-derived Anti Mouse GR primary antibody were purchased from Changzhou Affinity, the goat anti-rabbit secondary antibody was purchased from Wuhan Proteintech Company, and the ECL hypersensitive chemiluminescent reagent was purchased from Millipore Company in the United States. The brand of flow cytometer is Novo press, the brand of microplate reader is Bio-Tek, the brand of electrophoresis and developing equipment is Bio Rad, and the brand of amplification instrument is ViiA 7.

Experimental methodEstablishment of surgical stress model

Refer to the literature to establish the surgical stress model [7]. This model is widely used, and its advantage is that it causes less trauma to the mice, has little impact on the vital signs of the mice, and has a slight impact on other organs, making the model stable and easy to replicate. The specific operation was as follows: After the mice were fasted for 12 h, they were anesthetized and fixed with 2% sevoflurane, and the abdominal cavity was explored gently to prevent intestinal bleeding or damage to abdominal blood vessels. The operation lasted about 10 min. After the exploration, the muscle fascia and skin were sutured, and aseptic operation was guaranteed throughout the operation. The 42 mice were divided into 7 groups according to the random number table method, 6 in each group, respectively blank control (C) group, 2 h operation group, 6 h operation group, 12 h operation group, 24 h operation group, 48 h operation group, and 72 h operation group. surgery group. The experimental animals were sacrificed by cervical dislocation at 2 h, 6 h, 12 h, 24 h, 48 h, and 72 h after operation. The spleen was obtained, and the percentages of CD86 and CD206 on the surface of macrophages were detected by flow cytometry to select the time point for sampling after operation.

Preparation of spleen single cell suspension

After the animal was sacrificed, the mouse chest cavity was opened to expose the heart, the right atrial appendage was cut open, a 20 ml syringe was inserted into the left ventricle, and normal saline was injected slowly for perfusion until the liver turned white. Open the abdominal cavity, take out the spleen and place it in a petri dish with pre-cooled PBS, and peel off the connective tissue. Afterwards, the spleen was ground on a 200- mesh cell sieve, and at the same time, it was washed with PBS to collect the spleen tissue cell suspension. The resulting cell suspension was filtered through a 200- mesh cell sieve again and then centrifuged (1700 rpm, 5 min. The same below). Discard the supernatant, add 5 ml erythrocyte lysate and let it stand on ice for 10 min, during which time, turn it upside down twice to fully lyse it, and centrifuge again to discard the supernatant. Add 2 ml PBS to resuspend the cells.

Detecting the expression of CD86 and CD206 on the surface of macrophages by flow cytometry

Draw 100 ul of cell suspension into the flow cytometry tube, add flow cytometry antibodies FITC Anti Mouse F4/80, APC Anti Mouse CD86, PE Anti Mouse CD206, shake and mix well, and incubate on ice in the dark for 30 min. Add 2 ml PBS to wash twice, centrifuge to discard the supernatant, add 500 ul PBS to resuspend, and use flow cytometry for detection.

Explore the regulatory effect of electroacupuncture on surgical stress and macrophagesExperimental grouping and electroacupuncture adjustment methods

Part I: 24 mice were randomly divided into 4 groups, 6 in each group, namely blank control (C) group, operation ( S) group, electroacupuncture (E) group, and non-acupoint electroacupuncture (N) group. According to the " Acupoint Location Standards for Experimental Animals ", the mouse standard acupoints were located. After the acupoints were selected, 2/15 Hz sparse-dense wave electroacupuncture was given with a current of 1 mA. The electroacupuncture group and the non-acupoint electroacupuncture group were given one electroacupuncture stimulation 12 h before operation after anesthesia, and the other groups were only anesthetized without operation, and the electroacupuncture stimulation time was 30 min. Re- anesthetized and given electroacupuncture stimulation 10 min before the operation, the state of electroacupuncture stimulation was maintained during the operation, and the entire electroacupuncture stimulation time was 30 min. The stimulation sites in the electroacupuncture group were Zusanli and Sanyinjiao, and the stimulation sites in the non-acupoint electroacupuncture group were the buttock muscles 3 mm away from the depression between the base of the tail and the anus. Group C only underwent fixation, skin preparation, and povidone-iodine disinfection; Group S only underwent exploratory laparotomy without electroacupuncture stimulation.

Part II: 30 mice were randomly divided into 5 groups, 6 in each group, respectively blank control group (CON group), blank control + DMSO group (CD group), operation + DMSO group (SD group), operation + RU486 group (SR group), electroacupuncture group (EA group). The mice were weighed and recorded, and administered at 20 mg/kg. A certain amount of DMSO solution was injected intraperitoneally after anesthesia in the CD and SD groups 12 h before the operation, and the same amount of DMSO solution before the operation was injected again in the SD group 20 min after the operation, and then put back into the cage. In the SR group, the mice were anesthetized 12 h before the operation, and a certain amount of RU486 solution was injected intraperitoneally according to the weight of the mice, and then the mice were placed on the heat preservation pad and returned to the cage after they woke up naturally, and fasted. The SD and SR groups underwent exploratory laparotomy, and the EA group underwent electroacupuncture stimulation. The method was the same as the first part.

According to the above experimental results, the sample was collected at 12 h. The eyeballs were removed first to take blood. Afterwards, the mice were sacrificed by cervical dislocation, soaked in alcohol for 1 min, and then the chest cavity was opened for cardiac perfusion. After the liver turned white, the abdominal cavity was opened to take the spleen. Figure 1 is a work flow chart.

Fig. 1Detection of the percentage of CD86 + , CD206 + cells on the surface of macrophages by flow cytometry

The spleen was placed in a pre-cooled PBS culture dish, the connective tissue was peeled off, and part of the spleen was placed on a 200 -mesh cell sieve and thoroughly ground to obtain a spleen cell suspension. The remaining spleen tissue was stored in a -80 °C refrigerator. Take the resuspended splenocyte suspension and add flow cytometry antibodies FITC Anti Mouse F4/80, APC Anti Mouse CD86, PE Anti M ouse CD206, incubate on ice for 30 min, wash with 2 ml PBS, and centrifuge. After the cells were resuspended in 500 ul PBS, the percentages of CD86 + and CD206 + cells on the surface of macrophages were detected by flow cytometry.

Detecting the content of corticosterone (CORT) in mouse serum by Elisa

After removing the eyeball and taking blood, place the blood in a refrigerator at 4 °C overnight, centrifuge (3000 rpm, 15 min) and aspirate the supernatant. The CORT E lisa kit was used for detection, and the operation was carried out according to the instructions. The microplate reader detected the OD value of CORT in the serum of each group of mice, and the original software was used to calculate the content of CORT in peripheral blood.

q -PCR detection of carbon monoxide synthase (INOS), arginase -1 (A rg -1), TNF-α, IL—10, IL -1βm RNA expression in spleen

Take part of the spleen tissue and put it into a homogenization tube after weighing, add magnetic beads, add a certain amount of TRIzol according to the weight of the spleen, and place it in a homogenizer to fully homogenize and lyse to extract RNA. The concentration of extracted RNA was detected by UV spectrophotometer. Reverse transcription was performed using Evo M-MLV kit II, and the cDNA of the reverse transcription product was stored in a -20 °C refrigerator for later use. Take 1 ug cDNA according to SYBR Green Pro T aq HS premix _ The qPCR kit instructions were used to calculate the 2^ (-∆∆)CT value. The primers used in the experiment were: β-actin (F: 5'-GTCGTACCACAGGCATTGTGATGG-3', R: 5'-GCAATGCCTGGGTACATGGTGG-3'), INOS (F: 5'- ATTTTGCATGACACTCTTCACCCAC -3', R: 5'- TAGGCTTGTCTCTGGGTCCTCT—3'), Arg -1 (F: 5'- CATATCTGCCAAAGACATCGTG -3', R: 5'- GACATCAAAGCTCAGGTGAATC -3') TNF-α (F: 5'-ATGTCTCAGCCCTCTTCTCATTC-3', R: 5'-GCTTGTCACTCGAATTTTGAGA- 3') IL-10 (F: 5'- TTCTTTCAAACAAAGGACCAGC -3',R: 5'- GCAACCCAAGTAACCCTTAAAG -3'), IL-1β (F: 5'-GCTTCCAAACCTTTGACCTG-3',R: 5'-CTGTTGTTTCCCAGGAAGAC-3 ').

Detection of expression of spleen GR, NF-κB P65, NF-κB p -P65, IKBα, p -IKBα protein by Western Blot

Take part of the spleen tissue and put it into a homogenization tube after weighing, add magnetic beads, add RIPA lysate according to the weight of the spleen, and place it in a homogenizer to fully homogenize and lyse. After lysis, let stand on ice for 30 min and then centrifuge (15,000 rpm, 30 min), draw the supernatant into a clean EP tube, and use BCA kit for protein quantification. After adjusting the protein concentration to be consistent, add protein loading buffer and heat in a water bath at 100 °C for 10 min to denature the protein, then perform SDS-PAGE gel electrophoresis to separate the target protein and transfer it to a PVDF membrane, 5 Block with % skimmed milk at room temperature for 1 h, wash with TBST three times, add primary antibodies to GR, NF-κB p65, NF-κB p -P65, IKBα, p -IKBα, and α- tubulin, and incubate overnight in a refrigerator at 4 °C. Recover primary antibody, wash 3 times with TBST, add HRP- labeled goat anti-rabbit IgG secondary antibody, incubate at room temperature for 1 h, recover secondary antibody, wash 3 times with TBST, develop with ECL ultra-sensitive chemiluminescent solution, and use Image Lab software Analyze band gray values.

Statistical processing

SPSS 25 statistical software was used for statistical analysis. The measurement data of normal distribution were expressed as mean ± standard deviation ( ‾x ± s). When the variances were equal, the comparison of the means of multiple samples was performed by one-way analysis of variance. LSD- t method was used for comparison. Welchs's ANOVA was used to compare the means of multiple samples when the variances were not homogeneous, and the Games-Howell test method was used for pairwise comparisons between groups. P < 0.05 considered the difference to be statistically significant.