Isolation and culture of hUC-MSC

hUC-MSCs were cultured and identified as reported [17]. Briefly, the umbilical cord was obtained from pregnant women giving birth, who gave informed consent for umbilical cord collection. The procedure and subsequent use of the umbilical cord were approved by the ethical review committee of Yantai Yuhuangding Hospital (Approval NO. 2021-118, 2021-11-28). The Wharton's jelly was isolated from the umbilical cord and attached to culture plates supplemented with minimum essential medium α (MEMα) (C3060–0500, Biological Industries, Kibbutz, Israel) containing 10% fetal bovine serum (FBS) (C04001–500, Biological Industries, Kibbutz, Israel). After the colonies appeared to have 80% confluence, the cells were cultured into new plates. The cells cultured at passages 3–5 were used for the present study.

Cell identification for hUC-MSC

hUC-MSCs were characterized by the expression of cell surface markers. Briefly, the fourth passage cells at a concentration of approximately 5 × 106 were harvested, and resuspended at a concentration of 105 cells/500 μl in phosphate buffered solution (PBS) and incubated with monoclonal antibodies labelled with different fluorophores: CD34 (APC), CD45 (FITC), CD19 (PE), CD11b (R718), HLA-DR (RB780), CD44 (FITC), CD73 (BV510), CD105 (APC), and CD90 (FITC) and corresponding isotype controls (BD Biosciences Pharmingen, San Diego, CA, USA), respectively. After incubation for 30 min at room temperature (RT), hUC-MSCs were washed three times and resuspended in 500 μl PBS for flow cytometry analysis (MoFlo XDP, Beckman, USA). Cell death rates were analyzed using Trypan blue (C0011, Beyotime, Shanghai, China) staining.

In regard to multilineage differentiation, hUC-MSCs of passage 4 were cultured at a concentration of 3 × 104/well in a 6-well plate. After 80–90% confluence, MSCgo™ Osteogenic Differentiation Medium and MSCgo™ Adipogenic Differentiation Medium (05-440-1B, 05-330-1, Biological Industries, Kibbutz, Israel) were used to induce osteogenesis and adipogenesis, respectively. As for adipogenic differentiation, after differentiation culturing for 14–21 days, the medium was changed into MSC NutriStem XF Medium (05-200-1, Biological Industries, Kibbutz, Israel) for 3–4 days until lipid droplets formation. Alizarin Red S and Oil red-O were used to detect of successful osteogenic and adipogenic differentiations, respectively. In addition, 1 × 105/10 μl cells at the fourth passage were cultured in a U-bottom 96-well plate for 2 h to promote pellet formation, then 100 μl MSC NutriStem XF Medium was added into 96-well for 24 h. After 24 h, MSCgo™ Chondrogenic Differentiation Medium (05-220-1B, Biological Industries, Kibbutz, Israel) was used to replace the above medium for subsequent 14–21 days culture. The pellet was fixed in 4% formaldehyde, embedded in paraffin, cut into 4-μm-thick sections, and stained with Alcian Blue to detect chondrogenic differentiation.

Animal experiments

The Institute of Cancer Research (ICR) mice (6–8 weeks old, 30–35 g) were purchased from Beijing Vital River Laboratory Animal Technology Company. The mice were kept at a constant temperature (24 ± 2 ℃) and 12/12 light–dark cycle. The animals were free of food and drinking water. The experimental protocol was approved by the Ethical Committee on Animal Research of Yantai Yuhuangding Hospital.

As for the preliminary experiment, the mice were divided into 6 groups randomly as follows: (1) Control group: animals were injected physiological saline solution intraperitoneally followed by PBS (200 μl/mouse) 1 day later via tail vein (n = 3); (2) PTX group: animals were injected intraperitoneally with PTX solution (5 mg/kg body weight) once followed by PBS (200 μl/mouse) 1 day later via tail vein (n = 3); (3–6) PTX + hUC-MSCs groups: animals were injected intraperitoneally with PTX solution followed by different concentration of hUC-MSCs (5 × 105/200 μl/mouse, 1 × 106/200 μl/mouse, 2 × 106/200 μl/mouse, and 5 × 106/200 μl/mouse, n = 3, respectively) 1 day later via tail vein. A week later, mice were euthanized (1.25% 2,2,2-Tribromoethanol sterile anesthetic, 0.2 ml/kg, intraperitoneal injection). The testes were collected for morphology examination and antioxidant capacity detection.

For further investigation, the mice were divided into 3 groups randomly as follows: (1) Control group: animals were injected with physiological saline solution intraperitoneally once followed by PBS (200 μl/mouse) 1 day later via tail vein (n = 10); (2) PTX group: animals were injected intraperitoneally with PTX solution (5 mg/kg body weight) once followed by PBS (200 μl/mouse) 1 day later via tail vein (n = 10); (3) PTX + hUC-MSCs group: animals were injected intraperitoneally with PTX solution followed by hUC-MSCs (2 × 106/200 μl/mouse, based on preliminary experiment results) 1 day later via tail vein (n = 10). Two weeks later, mice were euthanized for subsequent experiments.

Normal estrous female mice were selected and mated with male mice in different groups at a ratio of 3:1. In the following morning, female mice with vaginal plug were identified for further observation to determine pregnancy status. To assess the embryo development, vaginal plug formation was recorded as 0.5 post-coitum (dpc), while pregnant female mice were euthanized at 7.5 dpc under anesthesia. Male fertility was evaluated by calculating the ratio of pregnant female mice to the number of female mice with vaginal plugs.

For external superovulation, normal female mice were injected intraperitoneally with 10 i.u. pregnant mare serum gonadotrophin (PMSG) and human chorionic gonadotrophin (hCG) 48 h apart. Each female mouse could produce about 35 oocytes, which were collected and cultured in a HTF medium. Mice cauda epididymal sperm in each group were collected for sperm capacitation in 200 μl CTYH medium for 0.5 h. About 106 sperm/ml was transferred into a human tubal fluid (HTF) medium containing oocytes. All procedures were done in a humidified incubator at 37 ℃ with 5% CO2. After sperm-egg incubation for 4–6 h, the developed embryos were recorded, and the fertility rate was defined as a ratio of pronuclear formation embryos/obtained oocytes. Pronuclear formation embryos were transferred into a balanced KSOM medium with a paraffin overlay for the following culture. The percentage of the two-cell embryos/the number of pronucleus formation oocytes was regarded as embryo development rate and the blastocytes/the number of the two-cell embryos was recorded as blastocyst rate.

Histological assay

After fixation in Bouin's solution for 12 h, mice testes were embedded in paraffin. The slides with 4 μm thickness were prepared. After dewaxing and dehydration, the slides were stained with hematoxylin and eosin (HE), and the morphological structures were observed under a light microscope (DM LB2, Leica, Germany).

TUNEL assay

TUNEL analysis was performed according to manufacturer’s instruction (BA2520, Biobox, Nanjing, China). The sections were de-waxed and dehydrated in xylene and ethanol, followed by incubation with proteinase K for 30 min at 37 ℃. After being immersed in blocking solution (0.1 M Tris–HCL PH7.5, 3% BSA, AND 20% FBS) for 10 min at RT, the sections were stained with a TUNEL detection solution. Images were captured by fluorescent microscopy (Observer 7, Carl Zeiss, Jena, Germany).

Immunohistochemical and immunofluorescent staining

Immunohistochemistry and immunofluorescent analysis were performed as previously described [18]. Briefly, the sections were dewaxed and dehydrated in xylene and ethanol, respectively. Then the sections were reacted with 3% H2O2 at RT for 5 min to remove endogenous hydrogen peroxides, and incubated with 3% bovine serum albumin (BSA) at RT for 1 h to block non-specific bindings. The sections were then incubated with primary antibody at 4 ℃ overnight, and following incubated with secondary antibody at RT for 1 h. 3, 3′- diaminobenzidine (DAB) Kit (ZLI-9018, Zhong-Shan Golden Bridge, Beijing, China) was finally applied to display the peroxidase activity at the binding sites. Harris hematoxylin solution (ZLI-9609, Zhong-Shan Golden Bridge, Beijing, China) was used to stain nuclei. The stained sections were dehydrated and observed under a light microscope (DM LB2, Leica). For immunofluorescent staining, the slides were incubated with corresponding fluorescent secondary antibody and PI or DAPI (1 μg/ml) (P0135, P0131, Beyotime, Shanghai, China) was used to stain nuclei. Fluorescent images were captured with a fluorescent microscope (Observer 7, Carl Zeiss, Jena, Germany) and analyzed by ImageJ software. The primary antibodies included Nuclear factor-erythroid 2-related factor 2 (NRF2) (AF7006, Affinity, Biosciences, JiangSu, China), Heat Shock 70 kDa Protein 2 (HSPA2) (ab108416), HSPA4L (ab231577), Proliferating cell nuclear antigen (PCNA) (ab92552), Sirtuin 1 (SIRT1) (ab189494, Abcam, Cambridge, UK), STEM121 (Y40410, Cellartis, Takara, Japan), and CD73 (AG2762, Beyotime, Shanghai, China).

Tracking of hUC-MSCs in vivo after injection

hUC-MSCs (1 × 108) were labelled with 5(6)-Carboxyfluorescein diacetate succinimidyl ester (CFDA-SE) (C0051, Beyotime, Shanghai, China). The labeled cells were washed three times with PBS and injected into 24 mice via tail vein 24 h after PTX treatment. The distribution of hUC-MSCs in the mice heart, liver, spleen, lung, kidney, and testis was detected at 8 different time points within 72 h (15 min, 30 min, 3 h, 6 h, 12 h, 24 h, 48 h and 72 h). Fluorescence signals in frozen sections (5 μm) were detected by a fluorescence microscope (Observer 7, Carl Zeiss, Jena, Germany) at a magnification of × 20.

Oxidative stress indicators detection

Oxidative stress related markers of superoxide dismutase (SOD) (S0103, Beyotime, Shanghai, China) and glutathione (GSH) (S0052, Beyotime, Shanghai, China) were detected. The testis tissue or cell lysate was extracted and measured according to manufacturer’s instruction. Optical density (OD) values were read using microplate reader (Varioskan, Thermo Scientific, Shanghai, China) and analyzed by ImageJ software.

Western blotting

Protein extractions were performed by grinding the tissues in liquid nitrogen, and lysing in Radio Immunoprecipitation Assay (RIPA) buffer (P0013, Beyotime, Shanghai, China) containing protease and phosphatase inhibitor cocktail (P1011, Beyotime, Shanghai, China). The protein concentrations were measured by a BCA protein assay kit (P0012, Beyotime, Shanghai, China). Equal proteins (50 μg/lane) from each sample were separated by 12% SDS-PAGE gels, transferred onto a nitrocellulose filter membrane and blocked with 5% (w/v) skimmed milk in tris-buffered saline containing 0.1% Tween 20 (TBST). The membranes were then hybridized overnight at 4 ℃ with primary antibodies: Proliferating cell nuclear antigen (PCNA), ab92552; Synaptonemal complex protein 3 (SYCP3), ab97672, Bcl-2-associated X protein (BAX), ab32503; B-cell lymphoma 2 (BCL2), ab182858; β-Tubulin (TUBB), ab179513, Abcam, Cambridge, UK; MutL homolog 1 (MLH1), D221003; DNA meiotic recombinase 1 (DMC1), D224646; Meiotic recombination protein (REC8), D222997; Catalase (CAT), D222036; Superoxide dismutase 1 (SOD1), D221245; Peroxiredoxin 6 (PRDX6), D121159, BBI, Shanghai, China). After washing with TBST for 3 times, the membrane was incubated with appropriate HRP-conjugated secondary antibody (ZB2305, Zhong-Shan Golden Bridge, Beijing, China, 1:5000) at RT for 1 h. After being washed by TBST, the protein bands were detected by an ECL kit (KF8001, Affinity Biosciences, JiangSu, China) using ChemiScope 6200 Touch (CLINX Science Instruments Co.,Ltd. China) and quantified with ImageJ software using TUBB as the loading control.

RNA isolation and real-time quantitative PCR

Total RNA was extracted from mice testis with RNA isolated Total RNA Extraction Reagent (R701-01, Vazyme, Nanjing, China) following the manufacturer’s instructions. 5 × All-In-One RT MasterMix with AccuRT (G592, Abm, Jiangsu, China) was used to synthesize cDNA from total RNA. RT-qPCR was performed with BlasTaq 2 × qPCR MasterMix (G891, Abm, Jiangsu, China) on ABI Prism 7500 (Thermo Scientific, Shanghai, China). The comparative delta cycle threshold (CT) method was used to calculate the relative expression levels of each target gene to Actb. All experiments were conducted 3 times. The primer sequences were as follows:

mSod1-F: AACCAGTTGTGTTGTCAGGAC, mSod1-R: CCACCATGTTTCTTAGAGTGAGG; mCat-F: TGGCACACTTTGACAGAGAGC, mCat-R: CCTTTGCCTTGGAGTATCTGG; mPrdx6-F: CATCCTTTTGGGCATGTTGG, mPrdx6-R: TGGCAGGGTAGAGGATAGAC; mActb-F: GCAGCTCAGTAACAGTCCGC, mActb-R: AGTGTGACGTTGACATCCGT.

Actb served as the control gene. The CT of each gene was recorded. △CT was the difference value of CTGene -CTActb.△△CT of each gene was the difference value of △CTtreatment -△CTcontrol. The results were displayed as 2−△△CT, and statistically analyzed by One-Way ANOVA.

Statistical analysis

All data were analyzed as the mean ± standard deviation of three independent repeats. The data were performed on normality tests, which used Anderson–Darling test. Then One-Way ANOVA analysis was performed by using Tukey test for multiple comparisons. GraphPad Prism 9 (GraphPad Prism, La Jolla, CA) was used to perform all the analysis, a p value less than 0.05 was considered significant.