A. Fabrication and characterization of stiff and soft matrices

Polydimethylsiloxane (PDMS) substrates were prepared by using SYLGARDTM 184 silicone elastomer kit (Dow Corning Corporation, USA). The mixtures of base and curing agent were mixed thoroughly and placed into the plastic petri dishes. By changing mass ratio of base to curing agent (e.g., 47:1 and 51:1), stiff and soft PDMS substrates were obtained by incubation of two mixtures at 60 °C for 6 h and cooling at room temperature overnight. PDMS disks with diameter of 8 mm were produced by cutting with biopsy punches. After sterilization, PDMS disks were washed with phosphate buffer saline (PBS) for three times. Collagen type I was extracted from the tendons of rat tail according to previously reported methods.4545. N. Rajan, J. Habermehl, M.-F. Cote, C. J. Doillon, and D. Mantovani, “ Preparation of ready-to-use, storable and reconstituted type I collagen from rat tail tendon for tissue engineering applications,” Nat. Protocols 1(6), 2753–2758 (2006). https://doi.org/10.1038/nprot.2006.430 The prepared lyophilized collagen was weighted and added in 10 mM HCl and gently stirred at 4 °C for 48 h until it was completely dissolved to obtain 5 mg/ml collagen solution. After being neutralized by 2 M NaOH, collagen solution was carefully poured into a petri dish containing clean PDMS disks. Finally, this Petri dish was put into an incubator (5% CO2, 37 °C) overnight for collagen coating. For characterization of mechanical property, PDMS substrates before and after collagen modification were compressed (compression rate: 1 mm/min) by a BOSE ELF 3200 dynamic mechanical analyzer (BOSE, USA). The Young's modulus of each PDMS substrate was calculated according to our previously published method.3434. Y. Ma, Y. Ji, T. Zhong, W. Wan, Q. Yang, A. Li, X. Zhang, and M. Lin, “ Bioprinting-based PDLSC-ECM screening for in vivo repair of alveolar bone defect using cell-laden, injectable and photocrosslinkable hydrogels,” ACS Biomater. Sci. Eng. 3(12), 3534–3545 (2017). https://doi.org/10.1021/acsbiomaterials.7b00601 For topological microstructure characterization, stiff and soft PDMS substrates with collagen modification were freeze-dried and surface-coated through sputter coating with Au for scanning electron microscopy (SEM) imaging. The topological microstructure and pore width of the collagen pattern were observed by a TM4000Plus SEM (Hitachi, Japan) with an accelerating voltage of 15 kV.

B. Cell culture

hMSCs were isolated from fresh periodontal membranes that were obtained from human teeth following the protocol described in our previous work.4646. W. Wan, B. Cheng, C. Zhang, Y. Ma, A. Li, F. Xu, and M. Lin, “ Synergistic effect of matrix stiffness and inflammatory factors on osteogenic differentiation of MSC,” Biophys. J. 117(1), 129–142 (2019). https://doi.org/10.1016/j.bpj.2019.05.019 Briefly, healthy human teeth were obtained from three young individuals (12–16 years old) who were treated for orthodontic reasons at the Stomatology Hospital of Xi'an Jiaotong University. In this study, the periodontal membrane surrounding the root was cut and digested in collagenase type I with concentration of 3 mg/ml (Sigma-Aldrich, USA) at 37 °C for 30 min. Subsequently, cell suspensions were filtered with a 40 μm cell strainer (Thermo Fisher Scientific, USA) and cultured with DMEM (Gibco, USA) containing 15% fetal bovine serum (Gibco, USA) and 100 U/ml penicillin streptomycin (Sigma-Aldrich, USA) in the incubator (5% CO2, 37 °C). Limiting dilution technique was used to gain single cell-derived cultures, then hMSCs were multiple colony-derived after 3–4 passage. hMSCs with the same passage were used in each experiment. Identification of the hMSCs through a flow cytometer was confirmed in our previous study.4646. W. Wan, B. Cheng, C. Zhang, Y. Ma, A. Li, F. Xu, and M. Lin, “ Synergistic effect of matrix stiffness and inflammatory factors on osteogenic differentiation of MSC,” Biophys. J. 117(1), 129–142 (2019). https://doi.org/10.1016/j.bpj.2019.05.019 For osteogenic differentiation, the growth media were replaced by the osteogenic media containing 10 mM β-glycerophosphate disodium, 50 μg/ml ascorbic acid, and 100 nM dexamethasone.

C. Cell behavior characterization

A Live/Dead Viability Kit (Life Technologies, USA) was used to character cell viability of hMSCs after cells were transferred to stiff matrices on day 3. According to the suggested protocol, cells were incubated with 0.05% v/v calcein-AM and 0.2% v/v propidium iodide at 37 °C for 15 min in the dark. Then, cells were washed with PBS and imaged using an FV3000 confocal microscope (Olympus, Japan). Data were analyzed by ImageJ software.

A Cell Count Kit-8 (CCK-8, Dojindo, Japan) was used cell proliferation evaluation. When hMSCs were transferred to stiff matrices and cultured for designed days, the growth media containing 10% v/v CCK-8 were added into the culture media and incubated at 37 °C for 4 h. A microplate reader (BioRad Laboratories, USA) was then used to measure the optical density (OD) of the reaction solution at 450 nm. Three replicates were measured for each group. Meanwhile, a standard curve was obtained. Briefly, a cell counting plate was used to count the number of hMSCs in the prepared cell suspension. Cell concentration gradients were obtained by sequentially diluting the cell suspension with growth media in equal proportion. Five cell concentrations were prepared, and six replicates were in each group. Then, cells were seeded in a 96-well plate and cultured for 2 h to attach to the well. After incubation with 10% v/v CCK-8 at 37 °C for 4 h, OD at 450 nm was measured for manufacturing a standard curve with cell number as abscissa (X-axis) and OD as ordinate (Y-axis). By using this standard curve, cell number of hMSCs cultured for designed days under different conditions was calculated for evaluating cell proliferation.

Cell spreading was assessed after hMSCs were transferred to stiff matrices on day 5. Cells were fixed by 4% paraformaldehyde for 15 min, permeabilized with 0.5% Triton for 10 min, and blocked with 5% bovine serum albumin (BSA) for 30 min. Rhodamine-labeled phalloidin (2 μg/ml, Cytoskeleton, Inc., USA) and 4′,6-diamidine-2′-phenylindole dihydrochloride (DAPI, 1 mg/ml, Sigma, USA) were used at 37 °C for 15 and 10 min for staining F-actin and nuclei, respectively. Images were taken by an FV3000 confocal microscopy (Olympus, Japan), and cell aspect ratio and cell area were analyzed by ImageJ software. 15 cells from biological triplicate were used for the quantitative analysis.

After short-term and long-term exposure to soft matrices, hMSCs were transferred to stiff matrices and cultured subsequently for 5 days. Cells were fixed by 4% paraformaldehyde for 15 min, permeabilized with 0.5% Triton for 10 min, and blocked with 5% BSA for 30 min. Then, cells were incubated with anti-Integrin beta 1 antibody (1:200, Abcam, ab30394) at 4 °C overnight. Goat anti-mouse IgG (Alexa Fluor® 488) (1:1000, Abcam, ab150113) was used as secondary antibodies at 4 °C for 1 h. Cell nuclei were stained with DAPI. An FV3000 confocal microscope (Olympus, Japan) was used for imaging, and ImageJ software was utilized to measure mean fluorescence intensity for quantitation of integrin β1 expression. Biological triplicate with three images per replicate were used for the quantitative analysis.

D. Cell differentiation characterization

At the early stage of osteogenic differentiation, alkaline phosphatase (ALP) activity was used to evaluate the degree of osteogenic differentiation of hMSCs. On day 10 after cell transfer to stiff matrices, cells were washed with PBS for three times and then stained with a BCIP/NBT alkaline phosphatase color development kit (C3206, Beyotime Institute of Biotechnology) at room temperature for 20 min. Images were taken through an ECLIPSE Ti inverted microscope (Nikon, Germany). To quantify ALP expression, at designed time points, cells were collected and lysed by RIPA lysis buffer (Thermo Fisher Scientific, USA) on ice for 20 min. Then, the lysates were centrifuged at 10 000 rpm for 12 min at 4 °C and analyzed by an ALP Assay Kit (A059–2–2, Nanjing Jiancheng Bioengineering Institute, China) according to the manufacturer's instructions. The ALP activity was normalized by the content of total protein determined by an Enhanced BCA Protein Assay Kit (P0010, Beyotime, China). ALP was performed in biological triplicate.

At the middle stage of osteogenic differentiation, expression of osteogenesis specific proteins, such as RUNX2 and osteopontin (OPN), was assessed. On day 14 after cell transfer to stiff matrices, cells were washed with PBS for three times initially. Then, cells were fixed by 4% paraformaldehyde for 15 min, permeabilized with 0.5% Triton for 10 min, and blocked with 5% BSA for 30 min. Next, cells were incubated with anti-RUNX2 antibody (1:100, Abcam, ab76956) and anti-OPN antibody (1:100, Abcam, ab8448) at 4 °C overnight, respectively. Goat anti-mouse IgG (Alexa Fluor® 488) (1:1000, Abcam, ab150113) and goat anti-rabbit IgG (Alexa Fluor® 488) (1:1000, Abcam, ab150077) were used as secondary antibodies at 4 °C for 1 h. Cell nuclei were stained with DAPI. To determine the role of chromatin organization in soft priming-regulated osteogenesis capacity, hMSCs with short-term preconditioning on soft matrices (e.g., 1 day of exposure) were treated with C646 (10 μM, MedChemExpress, HY-13823) according to the manufacturer's protocols. Cells with DMSO treatment were controls. RUNX2 expression in hMSCs (e.g., So1-St14) was evaluated on day 14. An FV3000 confocal microscope (Olympus, Japan) was used for imaging, and ImageJ software was utilized to measure mean fluorescence intensity for quantitation of protein expression. Biological triplicate with 3 images per replicate were used for the quantitative analysis.

The mRNA levels of RUNX2 and OPN were evaluated for the hMSCs cultured in osteogenic media for 14 days with varied preconditioning time on soft matrices. RNA Isolation Kit (QIAGEN, Germany) was initially used to isolate the total RNA of hMSCs, and PrimeScript RT Reagent Kit with genomic DNA Eraser (TaKaRa Bio, China) was then used to synthesize the complementary DNAs. Then the complementary DNAs were mixed with the SYBR Premix Ex Taq II Kit (TaKaRa Bio, China) and loaded in a 7500 Fast Real-Time PCR System (Applied Biosystems, CA) for 40 cycles at 95 °C for 3 s and 60 °C for 30 s. GAPDH was served as a housekeeping gene and the forward and reverse primers of GAPDH, RUNX2, and OPN are shown in Table I. Three independent RNA preparations were measured for each group. The RUNX2 and OPN messenger RNA expression values were calculated by the 2–ΔΔCt method (e.g., ΔCt = the mean cycle threshold Ct of the target gene—the mean Ct of GAPDH; ΔΔCt = ΔCt of experimental group—ΔCt of control group). Cells in St14 group were set as controls, and cells in So1-St14, So4-St14, and So7-St14 groups were set as experimental groups for gene expression. To determine the role of traction force-mediated mechanotransduction, hMSCs shortly exposed to soft matrices (e.g., 1 day of exposure) were treated with cytochalasin D (Maokangbio, MZ5802) according to the manufacturer's protocols. Cells treated with DMSO were set as controls.

TABLE I. Sequence of the forward and reverse primers for RT-PCR.

GenesForward primersReverse primersRUNX2CACAGAGCAATTAAAGTTACCTAGGTTTAGAGTCATCAAGOPNGTGCAGAGTCCAGCAAAGGTTCAGCCAACTCGTCACAGTCGAPDHGGACCTGACCTGCCGTCTAGTAGCCCAGGATGCCCTTGAG

At the late stage of osteogenic differentiation, alizarin red staining was used to determine the production of mineralized nodules. On day 21 after cell transfer to stiff matrices, cells were washed with PBS, fixed by 4% paraformaldehyde for 15 min, and stained with 40 mM alizarin red S (Sigma-Aldrich, USA) solution at 37 °C for 15 min. For quantitative result of alizarin red staining, the stained cells were incubated in disodium hydrogen phosphate solution containing cetylpyridinium chloride (10% w/v, 500 μl) at 37 °C for 15 min. A microplate reader (BioRad Laboratories, USA) was used to measure optical density of reaction solution at 570 nm. Alizarin red staining was performed in biological triplicate.

E. Immunostaining of YAP and lamin A/C

After cell receiving short-term and long-term preconditioning on soft matrices, cells were transferred to stiff matrices and cultured subsequently for designed times. cells were fixed by 4% paraformaldehyde for 15 min, permeabilized with 0.5% Triton for 10 min, and blocked with 5% BSA for 30 min. To analyze subcellular localization of YAP, anti-YAP (1:200, Abcam, ab52771) primary antibody was added and incubated with cells at 4 °C overnight. After removing this primary antibody, cells were incubated with goat anti-rabbit IgG (Alexa Fluor® 488) (1:1000, Abcam, ab150077) regarding as secondary antibody, rhodamine-labeled phalloidin (2 μg/ml, Cytoskeleton, Inc., USA), and DAPI (1 mg/ml, Sigma, USA) at 4 °C for 1 h. After washing with PBS twice, cells were imaged by an FV3000 confocal microscope (Olympus, Japan). By measuring the mean fluorescence intensity of the YAP staining in the nucleus and cytoplasm by ImageJ, YAP Nuc/Cyt ratio was calculated by dividing the mean fluorescence intensity of the YAP staining in the nucleus by that in the cytoplasm. To determine nuclear mechanics, anti-LaminA + Lamin C (1:200, Abcam, ab108595) primary antibody was added and incubated with cells at 4 °C overnight. Then, cells were incubated with goat anti-rabbit IgG (Alexa Fluor® 488) (1:1000, Abcam, ab150077) regarding as secondary antibody and DAPI (1 mg/ml, Sigma, USA) at 4 °C for 1 h. After washing with PBS twice, cell nuclei were imaged by an FV3000 confocal microscope (Olympus, Japan). Expression of lamin A/C was quantified by measuring the mean fluorescence intensity of lamin A/C staining in the nucleus by ImageJ.4444. M. Zhang, Q. Sun, Y. Liu, Z. Chu, L. Yu, Y. Hou, H. Kang, Q. Wei, W. Zhao, J. P. Spatz, C. Zhao, and E. A. Cavalcanti-Adam, “ Controllable ligand spacing stimulates cellular mechanotransduction and promotes stem cell osteogenic differentiation on soft hydrogels,” Biomaterials 268, 120543 (2021). https://doi.org/10.1016/j.biomaterials.2020.120543 15 cells from biological triplicate were used for quantitative analysis.

H. Statistical analysis

Characterization of PDMS substrates, for instance stiffness, was performed in n = 3 (with biological replicates); Cell proliferation, ALP, alizarin red staining, and PCR were performed in biological triplicate; Image-based quantifications were performed in at least biological triplicate and detailed throughout the methods and figure legends. Analyses of cell area, cell aspect ratio, nuclear surface area, fluorescence intensity, and YAP Nuc/Cyt ratio were performed by using ImageJ. Nuclear volume and chromatin organization were quantified by using a custom MATLAB script. Statistical analyses in the current study were performed by GraphPad Prism 7. Meanwhile, this software was used to perform t tests to determine significance. All data were reported as means ± standard deviation (S.D). Significance levels were set at *p < 0.05 and **p < 0.01.