1 INTRODUCTION

Neuropathic pain is one of the common surgical diseases. It is caused by diseases or surgery that lead to peripheral nerve damage, resulting in abnormal chronic pain and pain hypersensitivity reaction. The pathogenesis of neuropathic pain is complex. Studies have shown that tissue damage is the direct cause of neuropathic pain, which can directly affect the nervous system and induce the generation of bypass conduction ectopic discharge.1 However, the underlying mechanism that leads to neuropathic pain is not fully understood. Current treatment is mostly based on anesthetic drugs to relieve discomfort.

Microglia are important glial cells in the spinal cord, which are conducive to sensitization and maintenance of chronic pain.2 They are important components in the immune system and play a vital role in the regulation of inflammatory response in the central nervous system. Microglia change phenotypically into two polarized states when immune homeostasis is disturbed: an M1 (pro-inflammatory) phenotype and an M2 (anti-inflammatory) phenotype. Studies have shown that activated microglia stimulate the occurrence of pro-inflammatory response and release pro-inflammatory factors, such as TNF-α, IL-1β, and reactive oxygen species (ROS), which further induce neuronal damage and lead to neuropathic pain.3, 4 Besides, inhibition of the TREM2/TLR4/NF-κB pathway has been shown to promote microglial M2 polarization in BV2 cells, thereby inhibiting neuroinflammation.5

Senkyunolide H (SNH) is a compound isolated from Ligusticum chuanxiong Hort, a famous Chinese medicine, which is used to treat migraine and other diseases.6 SNH confers strong pharmacological activity. For example, SNH protects PC12 cells from MPP (+)-induced apoptosis and oxidative stress by regulating the mitogen-activated protein kinase (MAPK) pathway, providing a new scheme for the treatment of Parkinson's disease.7 SNH reduces the generation of osteoclasts and treats postmenopausal osteoporosis by suppressing the NF-κB, JNK, and ERK pathways.8 In addition, SNH inhibits the activation of microglial cells in the hippocampus of mice with intracerebral hemorrhage by downregulating TLR4 and p-NF-κB p65.9 However, there are very few reports on SNH in the therapy of neuropathic pain, and the mechanism is unclear. Therefore, we hypothesized that SNH could inhibit the activation of microglial BV2, attenuate inflammation and oxidative stress, thereby playing a role in the treatment of neuropathic pain.

In this study, our findings demonstrated that SNH suppressed lipopolysaccharide (LPS)-induced microglial BV2 activity in vitro by inhibiting the ERK and NF-κB pathways, and attenuated neuroinflammation and oxidative stress responses.

2 MATERIALS AND METHODS 2.1 Cell culture

Immortalized mouse BV2 microglial cell line was obtained from the Chinese Academy of Sciences (Shanghai, China). Cells were cultured in Dulbecco's Modified Eagle Medium (DMEM; Gibco, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS; Gibco), and 1% penicillin/streptomycin (Gibco) in an incubator maintained at 37°C and 5% CO2.

2.2 LPS exposure

To study the effects of SNH on BV2 microglial cells, BV2 cells were separated into five different groups: control, LPS, LPS + SNH (25 μM), LPS + SNH (50 μM), and LPS + SNH (100 μM). BV2 microglial cells were pretreated with or without LPS (1 μg/ml, extracted from Escherichia coli (O111:B4); Sigma-Aldrich, St. Louis, MO, USA) for 24 h, and treated with or without various concentrations of SNH (25, 50, and 100 μM; Sigma-Aldrich) for 2 h.

2.3 Western blot

Briefly, cells were washed three times with PBS, and total protein was extracted using RIPA buffer (Beyotime, Shanghai, China). A BCA protein assay kit (CoWin Biotechnology) was used to quantify protein concentrations. Total protein was electrophoresed by SDS-PAGE, and then transferred onto PVDF membranes (Millipore). Membranes were blocked with 5% non-fat milk for 1 h and incubated with specific primary antibodies: IBA1 (Rabbit anti-IBA1 antibody, ab153696, 1:2500; Abcam, Cambridge, MA, USA), p-ERK (Rabbit anti-p-ERK antibody, ab201015, 1:1500; Abcam), ERK (Rabbit anti-ERK antibody, ab17942, 1:3000; Abcam), p-JNK (Rabbit anti-p-JNK antibody, ab4821, 1:1500; Abcam), JNK (Rabbit anti-JNK antibody, AF1387, 1:3000; R&D system, Minneapolis, MN, USA), p-P38 (Rabbit anti-p-P38 antibody, ab4822, 1:1500; Abcam), P38 (Rabbit anti-P38 antibody, ab170099, 1:3000; Abcam), p-IkBα (Rabbit anti-p-IkBα antibody, ab133462, 1:3000; Abcam), IkBα (Rabbit anti-IkBα antibody, ab32518, 1:2500; Abcam), p-NF-κB p65 (ab86299, 1:1500; Abcam), NF-κB p65 (ab16502, 1:1500; Abcam), and β-actin (Rabbit anti-beta actin antibody, ab8227, 1:3000; Abcam). Then, membranes were incubated with HRP-conjugated goat anti-rabbit IgG secondary antibody (ab205718, 1:2000; Abcam) and the protein bands on the membranes were visualized using the ECL chemiluminescence reagent (Beyotime). The expression of β-actin was used as a loading control.

2.4 Immunofluorescence staining

Briefly, cells were fixed with 4% paraformaldehyde and permeabilized with 0.15% Triton X-100 for 30 min. Then, blocking was performed using 5% bovine serum albumin for 1.5 h, followed by incubation with rabbit anti-IBA1 antibody (ab153696, 1:1000; Abcam). Next, cells were incubated with florescent-dye conjugated secondary antibody (Beyotime) for 1.5 h followed by DAPI labeling.

2.5 Flow cytometry

Briefly, CD16/32 and CD206 were detected by immunofluorescence staining using the method described above.5 Cells were incubated with APC-conjugated CD16/32 antibody (eBiosciences, San Diego, CA, USA) or PE-conjugated CD206 antibody (eBiosciences) for 45 min. Light scatter characteristics of each sample (8 × 104 cells) were analyzed by flow cytometry (BD Accuri™ C6, USA).

2.6 Quantitative real-time polymerase chain reaction

Trizol reagent (Invitrogen, Grand Island, NY, USA) was used to extract total RNA from cells. The concentration and integrity of RNA was measured using a Nano Drop 1000 spectrophotometer (Thermo Fisher Scientific, Inc.). Amplification of cDNA was performed using the SYBR Premix EX Taq (Takara, Japan). The transcript levels of IL-10, IL-6, and IL-1β were assessed and normalized to the expression of β-actin, which acted as the endogenous reference gene.10 Primer sequences are shown in Table 1.

TABLE 1. Primers for IL-10, IL-6, IL-1β, and β-actin Gene Primer Sequence(5′ → 3′) IL-10 Forward TTACCTGGTAGAAGTGATGCCC Reverse GACACCTTGGTCTTGGAGCTTA IL-6 Forward CACATGTTCTCTGGGAAATCG Reverse TTGTATCTCTGGAAGTTTCAGATTGTT IL-1β Forward ACCTTCCAGGATGAGGACATGA Reverse CTAATGGGAACGTCACACACCA β-Actin Forward GTGACGTTGACATCCGTAAAGA Reverse GCCGGACTCATCGTACTCC 2.7 ELISA

Corresponding ELISA kits were used to determine the protein levels of IL-10 (ab100697; Abcam, Cambridge, MA, USA), IL-6 (ab100772; Abcam), IL-1β (ab100768; Abcam), glutathione (GSH) (ab65322; Abcam), catalase (CAT) (Catalase; RK02664; ABclonal, Wuhan, China), superoxide dismutase (SOD) (ab65354; Abcam), and nitric oxide (NO) (ab65328; Abcam), according to manufacturers' instructions.

2.8 Statistical analysis

All data are shown as mean ± standard error of the mean from three independent experiments. p values of <0.01 (two-tailed) were considered statistically significant. Statistical tests were performed using GraphPad Prism 5 (GraphPad Software, Inc.).

3 RESULTS 3.1 Senkyunolide H attenuates LPS-mediated activation of BV2

To evaluate the effects of SNH on LPS-mediated activation of BV2 microglial cells, BV2 microglial cells were exposed to various concentrations of SNH with or without LPS, and activation of BV2 was determined by assessing the protein levels of IBA1, a specific microglial marker, using western blot and immunostaining. Both western blot and immunostaining results revealed that SNH treatment attenuated LPS-mediated activation of BV2 in a dose-dependent manner (Figure 1A,B). BV2 microglial cells are known to play a double-edged role in various brain diseases through different microglial phenotypes, including deleterious M1 and neuroprotective M2. CD16/32 and CD206 were used as the markers for M1 and M2 phenotypes, respectively. To investigate the effects of SNH on LPS-mediated BV2 microglial cell polarization, the expression of CD206 and CD16/32 was measured by flow cytometry, which demonstrated that CD206 was markedly upregulated by SNH treatment in a dose-dependent manner compared with that of the LPS group in BV2 microglial cell (Figure 1C). Besides, SNH treatment significantly decreased the expression of CD16/32 in BV2 in a dose-dependent manner compared to that of the LPS group (Figure 1D). These results verified that SNH could reverse LPS-mediated activation of BV2 in a dose-dependent manner. BV2 microglial cells gradually shifted from an M1 phenotype to an M2 phenotype after SNH administration.

Senkyunolide H attenuates LPS-mediated activation of BV2 microglial cells. (A, B) The protein expression levels of IBA1 in each group of BV2 microglial cells were assessed by western blot and immunostaining. (C, D) CD16/32 (M1) and CD206 (M2) protein expression were measured using flow cytometry. Data are presented as mean ± SEM with three independent experiments. ***p < 0.001 versus control group, &p < 0.05, &&p < 0.01, and &&&p < 0.001 versus LPS-treated group. LPS, lipopolysaccharide

3.2 Senkyunolide H attenuates LPS-mediated neuroinflammation in BV2

To determine the effects of SNH on LPS-mediated neuroinflammation in BV2 microglial cells, inflammatory cytokines in BV2 were evaluated after treatment with or without LPS at different SNH doses. BV2 microglial cells were exposed to various concentrations of SNH with or without LPS, and the mRNA and protein expression levels of inflammatory cytokines in BV2 were assessed by quantitative real-time polymerase chain reaction (qRT-PCR) and ELISA, respectively. Both qRT-PCR and ELISA results indicated that SNH treatment increased the mRNA and protein expression of IL-10 (anti-inflammatory factor) while decreasing the mRNA and protein expression of IL-6 and IL-1β (proinflammatory factor), suggesting that SNH treatment attenuates LPS-mediated neuroinflammation in BV2 in a dose-dependent manner (Figure 2A,B).

Senkyunolide H attenuates LPS-mediated neuroinflammation in BV2 microglial cells. (A) The mRNA expression levels of IL-10, IL-6, and IL-1β in each group of BV2 microglial cells. (B) The protein expression levels of IL-10, IL-6, and IL-1β in each group of BV2 microglial cells. Data are presented as mean ± SEM with three independent experiments. **p < 0.01 and ***p < 0.001 versus control group, &p < 0.05, &&p < 0.01, and &&&p < 0.001 versus LPS-treated group. LPS, lipopolysaccharide

3.3 Senkyunolide H attenuates LPS-mediated oxidative stress in BV2 microglial cells

Furthermore, in order to determine the effects of SNH on LPS-mediated oxidative stress in BV2 microglial cells, ELISA was applied to assess the protein expression levels of GSH, CAT, SOD, and NO. The ELISA results indicated that compared with the control group, the protein expression levels of GSH, CAT, and SOD were drastically decreased while the NO levels were notably increased in the LPS-treated group, indicating that LPS induced oxidative stress. However, SNH significantly enhanced the protein expression of GSH, CAT, and SOD while reducing the protein expression of NO in the LPS group. Furthermore, the oxidative stress induced by LPS enhanced gradually with increasing dosages of LPS (Figure 3A–D). These results proved that SNH could reverse LPS-mediated oxidative stress in BV2 in a dose-dependent manner.

Senkyunolide H attenuates LPS-mediated oxidative stress in BV2 microglial cells. (A–D) The protein expression levels of GSH, CAT, SOD, and NO in each group of BV2 microglial cells. Data are presented as mean ± SEM with three independent experiments. **p < 0.01 and ***p < 0.001 versus control group, &p < 0.05, &&p < 0.01, and &&&p < 0.001 versus LPS-treated group. CAT, catalase; GSH, glutathione; LPS, lipopolysaccharide; NO, nitric oxide; SOD, superoxide dismutase

3.4 Senkyunolide H inhibits the ERK and NF-κB pathways

To investigate whether the ERK and NF-κB pathways are involved in the inhibitory roles of SNH on microglia activation, LPS-mediated neuroinflammation and oxidative stress in BV2, western blot was performed to assess the protein levels of ERK, JNK, P38, IKB-α, and NF-κB p65 in BV2 microglial cells. The western blot results demonstrated that the levels of phosphorylated ERK, JNK, and P38 were markedly upregulated in LPS-treated BV2 compared to that of the control group. However, the levels of phosphorylated ERK, JNK, and P38 were reversed in the LPS groups treated with SNH in a dose-dependent manner, indicating that SHN could inactivate the MAPK signaling pathway (Figure 4A). Furthermore, the phosphorylation levels of IKB-α, and NF-κB p65 also revealed a striking upregulation in BV2 after LPS treatment. Similarly, the levels of phosphorylated IKB-α, and NF-κB p65 were also reversed in the LPS groups treated with SNH in a dose-dependent manner, with obvious inhibitory effects at high doses of SNH, indicating that SNH could inactivate the NF-κB signaling pathway (Figure 4B). These results suggest that SNH could reverse LPS-mediated activation of microglia, LPS-mediated neuroinflammation and oxidative stress in BV2 via regulating the ERK and NF-κB pathways.

Senkyunolide H inhibits the ERK and NF-kB pathways. (A) The protein expression levels of ERK, JNK, and P38 in each group of BV2 microglial cells. (B) The protein expression levels of IKB-α and NF-kB p65 in each group of BV2 microglial cells. Data are presented as mean ± SEM with three independent experiments. ***p < 0.001 versus control group, &p < 0.05, &&p < 0.01, and &&&p < 0.001 versus LPS-treated group. LPS, lipopolysaccharide

4 DISCUSSION

Although medical science has advanced drastically, the molecular mechanism of neuropathic pain remains unclear. Recently, studies have suggested that SNH plays a vital anti-inflammatory and antioxidant role.9 However, SNH is rarely studied and its role remains poorly understood in the field neuropathic pain. Thus, understanding the molecular regulatory mechanism of SNH in neuropathic pain may provide important information that could lead to the identification of novel therapeutic targets for neuropathic pain.

SNH is a compound isolated from Ligusticum chuanxiong Hort, a famous Chinese medicine, which is used to treat cardiovascular diseases, inflammation, hypertension and vasodilation.11 Several other studies have reported that SNH markedly improves the symptoms of nervous system disease and diseases of other organs.12, 13 Specifically, studies have also found that SNH attenuates osteoclast genesis and osteoporosis via NF-κB, JNK, and ERK signaling.8 Recently, the role of SNH in MPP-induced apoptosis in PC12 cells via activating ROS-mediated MAPK pathway has been demonstrated.7 Moreover, SNH was found to reduce oxidative injury in liver by heme oxygenase-1.14 Due to its multi-target mechanisms of action, SNH is a promising natural product that could have a broad prospect in the development of new and safe drugs. However, so far very few studies had focused on the pharmacological value and the potential mechanism of SNH in neuropathic pain. This study has demonstrated that SNH treatment attenuated LPS-mediated activation of BV2 in a dose-dependent manner. In addition, our findings have also revealed that BV2 microglial cells gradually shifted from an M1 phenotype to an M2 phenotype after SNH administration. Furthermore, SNH was shown to confer anti-inflammatory and anti-oxidative stress effects on LPS-treated BV2. These results indicate that SNH may act as a promoting factor in improving the symptoms of neuropathic pain.

A growing number of studies have shown that SNH carries out its functions through regulating the expression of its target mRNAs. Previous study confirmed that SNH protects brain against ischemia–reperfusion injury via p-Erk1/2, Nrf2/HO-1, and caspase 3 signaling.15 Another novel discovery of this study was that ERK and NF-κB proteins are the targets of SNH. Activated ERK is involved in cell proliferation and differentiation, cell morphologic maintenance, cytoskeleton assembly, cell apoptosis and cell carcinogenesis.16 NF-κB is involved in cellular responses to many stimuli. Here, we have demonstrated that SNH targeted ERK and NF-κB as shown by western blot assays. LPS-induced increase in the ERK and NF-κB protein expression levels was dampened by increasing dosages of SNH, indicating that SNH inhibits activation of microglia and attenuates LPS-mediated neuroinflammation and oxidative stress in BV2 microglial cells by activating the ERK and NF-κB pathways.

In conclusion, this study reveals that SNH reverses LPS-mediated activation of BV2 in a dose-dependent manner, with significant inhibitory effects detected at high doses of SNH. Moreover, BV2 microglial cells gradually shift from an M1 phenotype to an M2 phenotype after SNH administration. Furthermore, SNH reduces inflammatory and oxidative stress responses in BV2 microglial cells. Lastly, this study demonstrates that SHN may improve the symptoms of neuropathic pain by inactivating the ERK and NF-κB pathways. Altogether, these results reveal the role of SNH/ERK/NF-κB signaling axis in improving the symptoms of neuropathic pain, which paves the path for the identification of advanced therapeutic targets in neuropathic pain.

CONFLICT OF INTEREST

The authors state that there are no conflicts of interest to disclose.